HrpB regulon and binding site collection in Burkholderia pseudomallei 1026b

HrpB - UniProtKB: A3P7B1 regulon and binding site collection of Burkholderia pseudomallei 1026b

Sites are listed as curated.

TTCGGCTGCCGCGACGCCGCTTCG
TTCGCATCCGGCGGCGCGGCTTCG
TTCGCGTTTCGACTTGCGGCTTCG
TTCGCATCCGGCGCGCGCGCTTCG

Sites are listed after the alignment process. For alignment of variable-length binding sites, LASAGNA is used.

TTCGGCTGCCGCGACGCCGCTTCG
TTCGCATCCGGCGGCGCGGCTTCG
TTCGCGTTTCGACTTGCGGCTTCG
TTCGCATCCGGCGCGCGCGCTTCG

Motif structure	Direct repeat
GC-content	70.83%
Regulatory mode	Activation	Repression	Dual	Not specified
Regulatory mode	100%	0%	0%	0%
TF conformation	Monomer	Dimer	Tetramer	Other	Not specified
TF conformation	0%	0%	0%	0%	100%
Binding site type	Motif-associated	Variable-motif-associated	Non-motif-associated
Binding site type	4	0	0

For the selected transcription factor and species, the list of curated binding sites in the database are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation.

Genome	TF	TF conformation	Site sequence	Site location	Experimental techniques	Gene regulation	Curations	PMIDs
NC_017832.1	A3P7B1	not specified	TTCGGCTGCCGCGACGCCGCTTCG	-[2153433:2153456]	Experimental technique details Beta-gal reporter assay Beta-gal reporter assay Reporter assay using the beta-galactosidase (lacZ) gene. The lacZ gene is typically fused to the promoter of interest. Differential regulation of the promoter mediated by the TF is assessed by induction of the system and evaluation of lacZ expression. Bacteria expressing lacZ appear blue when grown on a X-gal medium. The assay is often performed using a plasmid borne construction on a lacZ(def) strain. - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) Multiple sequence alignment (MSA) - ECO:0005556 MSA can be used to align promoter regions and highlight regions of conservation that may be indicative of transcription factor binding sites. - Experimental technique details RNA-Seq (ECO:0005664) RNA-Seq - ECO:0005664 In RNA-seq, RNA is extracted from the cell at a given time and reverse transcribed to obtain cDNA. This cDNA is then sequenced. This provides a snapshot of the "transcriptome" of an organism at a given time. - Experimental technique details Site directed mutagenesis (ECO:0005667) Site directed mutagenesis - ECO:0005667 Target-specific mutation, as opposed to non-specific mutation. In the context of TF-binding sites, site-directed mutagenesis is typically used to establish/confirm the specific sequence and location of a site, often in tandem with EMSA. Different positions of a putative binding site are mutated to non-consensus (or random) bases and binding to the mutated site is evaluated through EMSA or other means. Often implemented only in conserved motif positions or serially through all positions of a site.	BP1026B_RS27230 , BP1026B_RS27225 , BP1026B_RS27220 , BP1026B_RS27215 , BP1026B_RS27235	1129	21335458
NC_017832.1	A3P7B1	not specified	TTCGCATCCGGCGGCGCGGCTTCG	-[2167673:2167696]	Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) Multiple sequence alignment (MSA) - ECO:0005556 MSA can be used to align promoter regions and highlight regions of conservation that may be indicative of transcription factor binding sites. - Experimental technique details qRT-PCR [RNA] (ECO:0001808) qRT-PCR [RNA] - ECO:0001808 Quantitative Reverse-Transcription PCR is a modification of PCR in which RNA is first reverse transcribed into cDNA and this is amplified measuring the product (qPCR) in real time. It therefore allows one to analyze transcription by directly measuring the product (RNA) of a gene's transcription. If the gene is transcribed more, the starting product for PCR is larger and the corresponding volume of amplification is also larger. - Experimental technique details RNA-Seq (ECO:0005664) RNA-Seq - ECO:0005664 In RNA-seq, RNA is extracted from the cell at a given time and reverse transcribed to obtain cDNA. This cDNA is then sequenced. This provides a snapshot of the "transcriptome" of an organism at a given time.	BP1026B_RS27305 , BP1026B_RS27310 , BP1026B_RS27300 , BP1026B_RS27295 , BP1026B_RS27290 , ssaR (BP1026B_RS27285) , BP1026B_RS27280 , BP1026B_RS27275 , BP1026B_RS27315 , BP1026B_RS27320 , BP1026B_RS27325 , BP1026B_RS27330 , fliI (BP1026B_RS27335) , BP1026B_RS27340 , BP1026B_RS27345	1129	21335458
NC_017832.1	A3P7B1	not specified	TTCGCGTTTCGACTTGCGGCTTCG	-[2163967:2163990]	Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) Multiple sequence alignment (MSA) - ECO:0005556 MSA can be used to align promoter regions and highlight regions of conservation that may be indicative of transcription factor binding sites. - Experimental technique details RNA-Seq (ECO:0005664) RNA-Seq - ECO:0005664 In RNA-seq, RNA is extracted from the cell at a given time and reverse transcribed to obtain cDNA. This cDNA is then sequenced. This provides a snapshot of the "transcriptome" of an organism at a given time.	BP1026B_RS27290 , BP1026B_RS27295 , ssaR (BP1026B_RS27285) , BP1026B_RS27280 , BP1026B_RS27275	1129	21335458
NC_017832.1	A3P7B1	not specified	TTCGCATCCGGCGCGCGCGCTTCG	+[2167710:2167733]	Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) Multiple sequence alignment (MSA) - ECO:0005556 MSA can be used to align promoter regions and highlight regions of conservation that may be indicative of transcription factor binding sites. - Experimental technique details RNA-Seq (ECO:0005664) RNA-Seq - ECO:0005664 In RNA-seq, RNA is extracted from the cell at a given time and reverse transcribed to obtain cDNA. This cDNA is then sequenced. This provides a snapshot of the "transcriptome" of an organism at a given time.	BP1026B_RS27305 , BP1026B_RS27300 , BP1026B_RS27295 , BP1026B_RS27290 , ssaR (BP1026B_RS27285) , BP1026B_RS27280 , BP1026B_RS27275 , BP1026B_RS27310 , BP1026B_RS27315 , BP1026B_RS27320 , BP1026B_RS27325 , BP1026B_RS27330 , fliI (BP1026B_RS27335) , BP1026B_RS27340 , BP1026B_RS27345	1129	21335458

All binding sites in split view are combined and a sequence logo is generated. Note that it may contain binding site sequences from different transcription factors and different species. To see individiual sequence logos and curation details go to split view.

Sites are listed as curated.

TTCGGCTGCCGCGACGCCGCTTCG
TTCGCATCCGGCGGCGCGGCTTCG
TTCGCGTTTCGACTTGCGGCTTCG
TTCGCATCCGGCGCGCGCGCTTCG

Sites are listed after the alignment process. For alignment of variable-length binding sites, LASAGNA is used.

TTCGGCTGCCGCGACGCCGCTTCG
TTCGCATCCGGCGGCGCGGCTTCG
TTCGCGTTTCGACTTGCGGCTTCG
TTCGCATCCGGCGCGCGCGCTTCG

To generate the weblogo, aligned binding sites are used.

	Download data in FASTA format.
	Download data in TSV (tab-separated-value) format. For each binding site, all sources of evidence (i.e. experimental techniques and publication information) are combined into one record.
	Download raw data in TSV format. All reported sites are exported individually.
	Download data in Attribute-Relation File Format (ARFF).
	Download Position-Specific-Frequency-Matrix of the motif in TRANSFAC format.
	Download Position-Specific-Frequency-Matrix of the motif in JASPAR format.
	Download Position-Specific-Frequency-Matrix of the motif in raw FASTA format. The matrix consists of four columns in the order A C G T.