Binding site | Location | Publication | Experimental techniques used | Curation |
---|---|---|---|---|
TTCGCATCCGGCGGCGCGGCTTCG | - [2167674, 2167697] | 21335458 |
|
1129 |
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Gene | Locus tag | Description |
---|---|---|
BP1026B_RS27305 | BP1026B_RS27305 | type III secretion system protein HrcU |
BP1026B_RS27310 | BP1026B_RS27310 | type III secretion protein |
BP1026B_RS27300 | BP1026B_RS27300 | EscV/YscV/HrcV family type III secretion system export apparatus protein |
BP1026B_RS27295 | BP1026B_RS27295 | type III secretion protein HpaP |
BP1026B_RS27290 | BP1026B_RS27290 | type III secretion protein |
ssaR | BP1026B_RS27285 | EscR/YscR/HrcR family type III secretion system export apparatus protein |
BP1026B_RS27280 | BP1026B_RS27280 | EscS/YscS/HrcS family type III secretion system export apparatus protein |
BP1026B_RS27275 | BP1026B_RS27275 | hypothetical protein |
BP1026B_RS27315 | BP1026B_RS27315 | type III secretion protein HrpB2 |
BP1026B_RS27320 | BP1026B_RS27320 | EscJ/YscJ/HrcJ family type III secretion inner membrane ring protein |
BP1026B_RS27325 | BP1026B_RS27325 | type III secretion protein HrpB4 |
BP1026B_RS27330 | BP1026B_RS27330 | type III secretion system protein HrpB |
fliI | BP1026B_RS27335 | EscN/YscN/HrcN family type III secretion system ATPase |
BP1026B_RS27340 | BP1026B_RS27340 | type III secretion protein HrpB7 |
BP1026B_RS27345 | BP1026B_RS27345 | EscT/YscT/HrcT family type III secretion system export apparatus protein |