Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002e440
Genome
Burkholderia pseudomallei - NC_017832.1
TF
HrpB [UniProtKB:A3P7B1, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTCGGCTGCCGCGACGCCGCTTCG - [2153434, 2153457] 21335458 Experimental technique details Beta-gal reporter assay - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details RNA-Seq (ECO:0005664) - Experimental technique details Site directed mutagenesis (ECO:0005667) - 1129

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... BP1026B_RS27230 BP1026B_RS27225 BP1026B_RS27220 BP1026B_RS27215 BP1026B_RS27235
Gene Locus tag Description
BP1026B_RS27230 BP1026B_RS27230 hypothetical protein
BP1026B_RS27225 BP1026B_RS27225 sensor histidine kinase
BP1026B_RS27220 BP1026B_RS27220 DNA-binding response regulator
BP1026B_RS27215 BP1026B_RS27215 secretion protein
BP1026B_RS27235 BP1026B_RS27235 hypothetical protein