Fur - UniProtKB: P0C6C8 regulon and binding site collection of Vibrio cholerae O1 biovar El Tor str. N16961

Sites are listed as curated.


Sites are listed after the alignment process. For alignment of variable-length binding sites, LASAGNA is used.


For the selected transcription factor and species, the list of curated binding sites in the database are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation.

    Genome TF TF conformation Site sequence Site location Experimental techniques Gene regulation Curations PMIDs
    NC_002505.1 P0C6C8 dimer AAGATGATAATGAATCTCAAA +[89953:89973] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VC0091 , VC0090 , VC0092
    ... ... VC0091 VC0090 VC0092
    2 21750152
    NC_002505.1 P0C6C8 dimer TAAATGAGAACTATTATTATT +[102428:102448] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VC0106 , VC0107
    ... ... VC0106 VC0107
    2 21750152
    NC_002505.1 P0C6C8 dimer CAAATGATAGTAATTTTCATT +[294065:294085] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VC0284 , VC0283 , VC0285 , VC0286
    ... ... VC0284 VC0283 VC0285 VC0286
    2 21750152
    NC_002505.1 P0C6C8 dimer GTAATGATAACCTTTATCAAT -[638889:638909] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VC0608 , VC0607 , VC0606 , VC0609 , VC0610
    ... ... VC0608 VC0607 VC0606 VC0609 VC0610
    2 21750152
    NC_002505.1 P0C6C8 dimer TAAATAATAACAATTATCATT -[826030:826050] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VC0771 , VC0770
    ... ... VC0771 VC0770
    2 21750152
    NC_002505.1 P0C6C8 dimer TTAATAAAAACTATTCTCATT -[830079:830099] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VC0773 , VC0774 , VC0772 , VC0775
    ... ... VC0773 VC0774 VC0772 VC0775
    2 21750152
    NC_002505.1 P0C6C8 dimer CAAATGATAATAATTTGCAAT +[1337805:1337825] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VC1264 , ribA (VC1263) , VC1265 , VC1266 , VC1267
    ... ... VC1264 ribA VC1265 VC1266 VC1267
    2 21750152
    NC_002505.1 P0C6C8 dimer ATAATGAGAGCGTTTCTCAAT -[1660976:1660996] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VC1548 , VC1547 , VC1546 , VC1545 , VC1544 , VC1543 , VC1549
    ... ... VC1548 VC1547 VC1546 VC1545 VC1544 VC1543 VC1549
    2 21750152
    NC_002505.1 P0C6C8 dimer AATGTGATAATAATTATCATT +[1684081:1684101] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VC1572 , VC1571 , VC1570 , VC1569 , VC1568 , VC1567 , VC1566 , VC1565 , VC1564 , VC1563 , fumC (VC1573)
    ... ... VC1572 VC1571 VC1570 VC1569 VC1568 VC1567 VC1566 VC1565 VC1564 VC1563 fumC
    2 21750152
    NC_002505.1 P0C6C8 dimer TTGTCGATAATAATTCTCATT +[1821440:1821460] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VC1688 , VC1687 , VC1686 , VC1685 , VC1684 , VC1683 , VC1682 , VC1681 , VC1680 , VC1689
    ... ... VC1688 VC1687 VC1686 VC1685 VC1684 VC1683 VC1682 VC1681 VC1680 VC1689
    2 21750152
    NC_002505.1 P0C6C8 dimer TTAATAATAATCATTATCAAT +[2360718:2360738] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) vibF (VC2209) , VC2210
    ... ... vibF VC2210
    2 21750152
    NC_002505.1 P0C6C8 dimer CAAATGAGAATGTATATCATT +[2361838:2361858] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VC2210 , VC2211
    ... ... VC2210 VC2211
    2 21750152
    NC_002505.1 P0C6C8 dimer CAAATGTAAAGCATTCTCATT +[2364355:2364375] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VC2211 , VC2212
    ... ... VC2211 VC2212
    2 21750152
    NC_002505.1 P0C6C8 dimer TTAATGATAATTAATATCATT -[2861930:2861950] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VC2694 , cpxA (VC2693) , VC2692
    ... ... VC2694 cpxA VC2692
    2 21750152
    NC_002505.1 P0C6C8 dimer AATCTGTAAGCCTTTCTCAAT -[974984:975004] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VC0913 , VC0912 , tRNA-Tyr-5 (VCt054) , VC0914
    ... ... VC0913 VC0912 tRNA-Tyr-5 VC0914
    2 21750152
    NC_002505.1 P0C6C8 dimer TAAATGAGAACGATTTTCTTG +[1310198:1310218] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VC1235 , VC1236
    ... ... VC1235 VC1236
    2 21750152
    NC_002505.1 P0C6C8 dimer TAACTAAGAATTAAATTCTAG +[2164783:2164803] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VC2011 , VC2012
    ... ... VC2011 VC2012
    2 21750152
    NC_002505.1 P0C6C8 dimer AACTTGACCATCAATCTCTTT -[2484093:2484113] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VC2333 , VC2332 , VC2331 , VC2330 , VC2334 , VC2335 , VC2336
    ... ... VC2333 VC2332 VC2331 VC2330 VC2334 VC2335 VC2336
    2 21750152
    NC_002505.1 P0C6C8 dimer TTCTCTAACATTGTTCTAAAT -[2240531:2240551] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VC2080 , VC2079 , VC2081
    ... ... VC2080 VC2079 VC2081
    2 21750152
    NC_002505.1 P0C6C8 dimer CAATTGATAACCAATCTCAAC -[134810:134830] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VC0142 , VC0143
    ... ... VC0142 VC0143
    2 21750152
    NC_002505.1 P0C6C8 dimer TGTTCAAGAACTATTCTAAAC -[16611:16631] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) avtA (VC0019) , glyS (VC0020) , glyQ (VC0021)
    ... ... avtA glyS glyQ
    2 21750152
    NC_002505.1 P0C6C8 dimer CGTCAATGAGTTTTTCTCATT -[33106:33126] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VC0034 , VC0033 , VC0035 , VC0036
    ... ... VC0034 VC0033 VC0035 VC0036
    2 21750152
    NC_002505.1 P0C6C8 dimer CAACTGAAAATGTTTCTCAAG +[243844:243864] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VC0239 , VC0238 , VC0237 , VC0236 , VC0235 , VC0234 , VC0233 , VC0232 , VC0231 , VC0230 , VC0229 , VC0228 , VC0227 , VC0226 , VC0225 , VC0224 , rfaD (VC0240)
    ... ... VC0239 VC0238 VC0237 VC0236 VC0235 VC0234 VC0233 VC0232 VC0231 VC0230 VC0229 VC0228 VC0227 VC0226 VC0225 VC0224 rfaD
    2 21750152
    NC_002505.1 P0C6C8 dimer TGGGTGAGCAGGGTTCTCAAT +[2628112:2628132] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) pyrG (VC2448) , eno (VC2447) , VC2449 , mazG (VC2450)
    ... ... pyrG eno VC2449 mazG
    2 21750152
    NC_002505.1 P0C6C8 dimer GCGCTAATAACCTTTCTCATC -[4346:4366] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) rnpA (VC0006) , VC0005 , VC0004 , rpmH (VC0007)
    ... ... rnpA VC0005 VC0004 rpmH
    2 21750152
    NC_002505.1 P0C6C8 dimer CGTCTGAGAATAATTCGTATT +[74750:74770] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VC0073 , VC0072 , VC0074
    ... ... VC0073 VC0072 VC0074
    2 21750152
    NC_002505.1 P0C6C8 dimer AAACGGGTAAATTATCTCTTG +[943826:943846] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VC0882 , VC0881 , VC0883 , VC0884 , VC0885 , VC0886
    ... ... VC0882 VC0881 VC0883 VC0884 VC0885 VC0886
    2 21750152
    NC_002505.1 P0C6C8 dimer CGAGCGAAAGTCATTCTCATC -[997774:997794] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VC0931 , VC0930 , VC0932 , VC0933
    ... ... VC0931 VC0930 VC0932 VC0933
    2 21750152
    NC_002505.1 P0C6C8 dimer TAATTGATAATTATTATCATG +[1079773:1079793] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VC1009 , VC1008 , VC1010 , VC1011 , VC1012 , VC1013 , rnfD (VC1014) , VC1015 , VC1016 , VC1017
    ... ... VC1009 VC1008 VC1010 VC1011 VC1012 VC1013 rnfD VC1015 VC1016 VC1017
    2 21750152
    NC_002505.1 P0C6C8 dimer TAACTGATAACGATTCTCATT +[2156707:2156727] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) rrmA (VC2003) , VC2002 , VC2004
    ... ... rrmA VC2002 VC2004
    2 21750152
    NC_002505.1 P0C6C8 dimer ACCGCGAAAAAGATTCTCAAC -[2387858:2387878] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VC2232 , fadE (VC2231) , VC2233
    ... ... VC2232 fadE VC2233
    2 21750152
    NC_002505.1 P0C6C8 dimer ATGTTGAGAGCTTATCCCATT +[2669146:2669166] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VC2489 , VC2488 , VC2487 , VC2490
    ... ... VC2489 VC2488 VC2487 VC2490
    2 21750152
    NC_002505.1 P0C6C8 dimer GCGTAGTTCATCATTATCATT -[2683602:2683622] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VC2498 , tRNA-Leu-10 (VCt086) , VC2499 , VC2500
    ... ... VC2498 tRNA-Leu-10 VC2499 VC2500
    2 21750152
    NC_002505.1 P0C6C8 dimer AAATTGTACCGTATTCTCATC -[2911737:2911757] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VC2738 , VC2737 , VC2739 , VC2740
    ... ... VC2738 VC2737 VC2739 VC2740
    2 21750152
    NC_002505.1 P0C6C8 dimer ATGACAGTCGGTATTATCATG -[49925:49945] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VC0052 , VC0051 , VC0053 , VC0054 , VC0055
    ... ... VC0052 VC0051 VC0053 VC0054 VC0055
    2 21750152
    NC_002505.1 P0C6C8 dimer CAAATGATAACTGCTCTCAAT +[936876:936896] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VC0872 , VC0871 , VC0873 , VC0874 , VC0875
    ... ... VC0872 VC0871 VC0873 VC0874 VC0875
    2 21750152
    NC_002506.1 P0C6C8 dimer CAAATGATAATTGATCTTATT +[68797:68817] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VCA0063 , VCA0062 , VCA0061 , VCA0060 , VCA0064 , VCA0065 , VCA0066 , VCA0067
    ... ... VCA0063 VCA0062 VCA0061 VCA0060 VCA0064 VCA0065 VCA0066 VCA0067
    3 21750152
    NC_002506.1 P0C6C8 dimer CAAATGATAACGATTCGCATA -[253569:253589] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VCA0232 , VCA0231 , VCA0230 , VCA0229 , VCA0228
    ... ... VCA0232 VCA0231 VCA0230 VCA0229 VCA0228
    3 21750152
    NC_002506.1 P0C6C8 dimer CAAATGATAGCAATTATCATT +[514882:514902] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VCA0576 , VCA0575 , VCA0574
    ... ... VCA0576 VCA0575 VCA0574
    3 21750152
    NC_002506.1 P0C6C8 dimer CAATTGATAATTATTATCAAT +[562566:562586] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VCA0625 , VCA0624 , VCA0623 , VCA0626
    ... ... VCA0625 VCA0624 VCA0623 VCA0626
    3 21750152
    NC_002506.1 P0C6C8 dimer CATTTGAGAATAAATTGCATT +[924307:924327] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VCA0976 , VCA0975 , VCA0977
    ... ... VCA0976 VCA0975 VCA0977
    3 21750152
    NC_002506.1 P0C6C8 dimer TGTTTAAGAGTGATTCGCAAC +[346424:346444] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VCA0354 , VCA0355
    ... ... VCA0354 VCA0355
    3 21750152
    NC_002506.1 P0C6C8 dimer CGAATGGGAAGAATTCTAATC -[1047231:1047251] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VCA1092 , VCA1091 , VCA1090 , VCA1089 , VCA1088 , VCA1087 , VCA1086 , VCA1093 , VCA1094 , VCA1095 , VCA1096 , VCA1097
    ... ... VCA1092 VCA1091 VCA1090 VCA1089 VCA1088 VCA1087 VCA1086 VCA1093 VCA1094 VCA1095 VCA1096 VCA1097
    3 21750152
    NC_002506.1 P0C6C8 dimer CCTTTGATAATGATTCTCAAT +[404285:404305] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VCA0452 , VCA0453
    ... ... VCA0452 VCA0453
    3 21750152
    NC_002506.1 P0C6C8 dimer GAGACCGAATCTATTCTCAAT +[580824:580844] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VCA0645 , VCA0646 , VCA0647 , VCA0648 , VCA0649
    ... ... VCA0645 VCA0646 VCA0647 VCA0648 VCA0649
    3 21750152
    NC_002506.1 P0C6C8 dimer TACTCCTTCACTATTCTCAAT +[899529:899549] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VCA0947 , VCA0946 , VCA0948
    ... ... VCA0947 VCA0946 VCA0948
    3 21750152
    NC_002506.1 P0C6C8 dimer GTATCTACAGCTAATTTCATT +[846744:846764] Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VCA0894 , VCA0893 , VCA0895
    ... ... VCA0894 VCA0893 VCA0895
    3 21750152
    NC_002506.1 P0C6C8 dimer TTAATAATAGCAATTATCAAT -[865521:865541] Experimental technique details ChIP-PCR (ECO:0005620) - Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VCA0910 , VCA0909 , VCA0908 , VCA0907 , VCA0911 , VCA0912 , VCA0913 , VCA0914 , hmuV (VCA0915)
    ... ... VCA0910 VCA0909 VCA0908 VCA0907 VCA0911 VCA0912 VCA0913 VCA0914 hmuV
    4 21750152
    NC_002506.1 P0C6C8 dimer GACATGATTTTTATTCTCATG +[1053330:1053350] Experimental technique details ChIP-PCR (ECO:0005620) - Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VCA1098 , VCA1097 , VCA1096 , VCA1095 , VCA1094 , VCA1093 , VCA1092 , VCA1091 , VCA1090 , VCA1089 , VCA1088 , VCA1087 , VCA1086 , VCA1099 , VCA1100 , VCA1101
    ... ... VCA1098 VCA1097 VCA1096 VCA1095 VCA1094 VCA1093 VCA1092 VCA1091 VCA1090 VCA1089 VCA1088 VCA1087 VCA1086 VCA1099 VCA1100 VCA1101
    4 21750152
    NC_002505.1 P0C6C8 dimer TAAATGATAATTATTCTTAAT -[504768:504788] Experimental technique details ChIP-PCR (ECO:0005620) - Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VC0474 , VC0475
    ... ... VC0474 VC0475
    5 21750152
    NC_002505.1 P0C6C8 dimer CTCTTCTTTGAGATTCTCAAT +[554648:554668] Experimental technique details ChIP-PCR (ECO:0005620) - Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VC0519 , dnaG (VC0518) , rpsU (VC0520)
    ... ... VC0519 dnaG rpsU
    5 21750152
    NC_002505.1 P0C6C8 dimer CCCTTGATAACGGATCTCAAA -[564604:564624] Experimental technique details ChIP-PCR (ECO:0005620) - Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VC0533 , pcm (VC0532) , surE (VC0531) , truD (VC0530) , ispF (VC0529) , ispD (VC0528) , ftsB (VC0527) , VC0534
    ... ... VC0533 pcm surE truD ispF ispD ftsB VC0534
    5 21750152
    NC_002505.1 P0C6C8 dimer CTCACATTCACGAATATCATT -[594563:594583] Experimental technique details ChIP-PCR (ECO:0005620) - Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VC0559 , VC0560
    ... ... VC0559 VC0560
    5 21750152
    NC_002505.1 P0C6C8 dimer TAATTAATAATTATTCTCAAG -[940564:940584] Experimental technique details ChIP-PCR (ECO:0005620) - Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VC0877 , VC0876 , rpmE2 (VC0878) , rpmJ (VC0879)
    ... ... VC0877 VC0876 rpmE2 rpmJ
    5 21750152
    NC_002505.1 P0C6C8 dimer AATCTGTAAGCCTTTCTCAAT -[974984:975004] Experimental technique details ChIP-PCR (ECO:0005620) - Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VC0913 , VC0912 , tRNA-Tyr-5 (VCt054) , VC0914
    ... ... VC0913 VC0912 tRNA-Tyr-5 VC0914
    5 21750152
    NC_002505.1 P0C6C8 dimer CAATTGATAACCAATCTCAAC -[134810:134830] Experimental technique details ChIP-PCR (ECO:0005620) - Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) VC0142 , VC0143
    ... ... VC0142 VC0143
    5 21750152
    NC_002505.1 P0C6C8 dimer TTAAATGAGAACTATTATT +[102427:102445] Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) VC0105 , VC0106 , VC0102 , VC0103 , VC0104 , VC0107 , VC0108 , VC0109
    ... ... VC0105 VC0106 VC0102 VC0103 VC0104 VC0107 VC0108 VC0109
    429 16299312
    NC_002505.1 P0C6C8 dimer TTTAATTAAGATAATTATC +[206406:206424] Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) VC0200 , VC0199 , VC0198 , VC0201 , VC0202 , VC0203 , VC0204 , VC0205 , murQ (VC0206) , murP (VC0207) , VC0208 , VC0209
    ... ... VC0200 VC0199 VC0198 VC0201 VC0202 VC0203 VC0204 VC0205 murQ murP VC0208 VC0209
    429 16299312
    NC_002505.1 P0C6C8 dimer GAAAATTACTATCATTTGT -[294064:294082] Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) VC0284 , VC0283 , VC0285 , VC0286
    ... ... VC0284 VC0283 VC0285 VC0286
    429 16299312
    NC_002505.1 P0C6C8 dimer ATCAATAATGAAAATTACT -[294073:294091] Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) VC0284 , VC0283 , VC0285 , VC0286
    ... ... VC0284 VC0283 VC0285 VC0286
    429 16299312
    NC_002505.1 P0C6C8 dimer GATAATTATTCTTAATTTC -[504765:504783] Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) VC0474 , VC0473 , VC0475
    ... ... VC0474 VC0473 VC0475
    429 16299312
    NC_002505.1 P0C6C8 dimer GATAAAGGTTATCATTACT +[638892:638910] Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) VC0608 , VC0607 , VC0606 , VC0609 , VC0610 , VC0611 , VC0612 , VC0613 , VC0614 , VC0615 , VC0616 , VC0617 , VC0618 , VC0619
    ... ... VC0608 VC0607 VC0606 VC0609 VC0610 VC0611 VC0612 VC0613 VC0614 VC0615 VC0616 VC0617 VC0618 VC0619
    429 16299312
    NC_002505.1 P0C6C8 dimer GATAATTGTTATTATTTAC +[826033:826051] Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) VC0771 , VC0770 , VC0772 , VC0773
    ... ... VC0771 VC0770 VC0772 VC0773
    429 16299312
    NC_002505.1 P0C6C8 dimer GCAAATGTAATCTGTTGCG -[830051:830069] Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) VC0773 , VC0772 , VC0771 , VC0774 , VC0775
    ... ... VC0773 VC0772 VC0771 VC0774 VC0775
    429 16299312
    NC_002505.1 P0C6C8 dimer ATAAATGCAAGCAATTTCC +[830099:830117] Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) VC0774 , VC0773 , VC0772 , VC0771 , VC0775
    ... ... VC0774 VC0773 VC0772 VC0771 VC0775
    429 16299312
    NC_002505.1 P0C6C8 dimer AATATTGATTCTCATTTCG -[832465:832483] Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) VC0775 , VC0776 , VC0774 , VC0777 , VC0778 , VC0779 , VC0780 , VC0781 , VC0782 , VC0783 , VC0784
    ... ... VC0775 VC0776 VC0774 VC0777 VC0778 VC0779 VC0780 VC0781 VC0782 VC0783 VC0784
    429 16299312
    NC_002505.1 P0C6C8 dimer CGGAATAAAGAGAATTTTG +[835630:835648] Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) VC0779 , VC0778 , VC0777 , VC0776 , VC0780 , VC0781 , VC0782 , VC0783 , VC0784
    ... ... VC0779 VC0778 VC0777 VC0776 VC0780 VC0781 VC0782 VC0783 VC0784
    429 16299312
    NC_002505.1 P0C6C8 dimer GATAATGAGAGCGTTTCTC -[1660979:1660997] Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) VC1548 , VC1547 , VC1546 , VC1545 , VC1544 , VC1543 , VC1549 , VC1550 , VC1551 , ugpC (VC1552) , VC1553 , VC1554 , VC1555 , VC1556 , VC1557 , VC1558
    ... ... VC1548 VC1547 VC1546 VC1545 VC1544 VC1543 VC1549 VC1550 VC1551 ugpC VC1553 VC1554 VC1555 VC1556 VC1557 VC1558
    429 16299312
    NC_002505.1 P0C6C8 dimer GATAATAATTATCATTTAA +[1684086:1684104] Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) fumC (VC1573) , VC1571 , VC1570 , VC1569 , VC1568 , VC1567 , VC1566 , VC1565 , VC1564 , VC1563 , VC1562 , VC1561 , VC1560 , VC1559 , VC1572 , VC1574 , VC1575 , VC1576
    ... ... fumC VC1571 VC1570 VC1569 VC1568 VC1567 VC1566 VC1565 VC1564 VC1563 VC1562 VC1561 VC1560 VC1559 VC1572 VC1574 VC1575 VC1576
    429 16299312
    NC_002505.1 P0C6C8 dimer AGTAATATTTCTTATTAAC -[2236267:2236285] Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) VC2078 , VC2077 , VC2076 , VC2079 , VC2080
    ... ... VC2078 VC2077 VC2076 VC2079 VC2080
    429 16299312
    NC_002505.1 P0C6C8 dimer GATAATGATTATTATTAAC -[2360717:2360735] Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) vibF (VC2209) , VC2208 , VC2207 , VC2206 , VC2205 , VC2204 , flgA (VC2203) , VC2202 , VC2201 , VC2210
    ... ... vibF VC2208 VC2207 VC2206 VC2205 VC2204 flgA VC2202 VC2201 VC2210
    429 16299312
    NC_002505.1 P0C6C8 dimer GTTAATGATATACATTCTC -[2361843:2361861] Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) VC2210 , VC2211
    ... ... VC2210 VC2211
    429 16299312
    NC_002505.1 P0C6C8 dimer GCAAATGAGAATGCTTTAC -[2364360:2364378] Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) VC2211 , VC2212 , VC2213
    ... ... VC2211 VC2212 VC2213
    429 16299312
    NC_002505.1 P0C6C8 dimer GTGAATTATTAAGATTCTC -[2364332:2364350] Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) VC2211 , VC2212 , VC2213
    ... ... VC2211 VC2212 VC2213
    429 16299312
    NC_002505.1 P0C6C8 dimer GTTAATGATATTAATTATC +[2861927:2861945] Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) VC2694 , cpxA (VC2693) , VC2692 , VC2695 , fxsA (VC2696) , VC2697
    ... ... VC2694 cpxA VC2692 VC2695 fxsA VC2697
    429 16299312
    NC_002505.1 P0C6C8 dimer GAGATTCATTATCATCTTC -[89952:89970] Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) VC0091 , VC0090 , VC0089 , VC0092
    ... ... VC0091 VC0090 VC0089 VC0092
    429 16299312
    NC_002505.1 P0C6C8 dimer CTTATTTGAGATTCATTAT -[89959:89977] Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) VC0091 , VC0090 , VC0089 , VC0092
    ... ... VC0091 VC0090 VC0089 VC0092
    429 16299312
    NC_002505.1 P0C6C8 dimer AGAAATAAGAGTGATTCTC +[383190:383208] Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) VC0364 , VC0363 , tuf (VC0362) , VC0361 , VC0360 , rpsL (VC0359) , VC0365
    ... ... VC0364 VC0363 tuf VC0361 VC0360 rpsL VC0365
    429 16299312
    NC_002505.1 P0C6C8 dimer GTGATTCTCTTTTATTCTT +[383200:383218] Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) VC0364 , VC0363 , tuf (VC0362) , VC0361 , VC0360 , rpsL (VC0359) , VC0365
    ... ... VC0364 VC0363 tuf VC0361 VC0360 rpsL VC0365
    429 16299312
    NC_002505.1 P0C6C8 dimer AGAAATCGACCTTATTGTG +[844693:844711] Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) VC0788 , VC0787 , VC0786 , VC0785
    ... ... VC0788 VC0787 VC0786 VC0785
    429 16299312
    NC_002505.1 P0C6C8 dimer CTTATTGCGAGTGATTCTC +[1118382:1118400] Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) fadJ (VC1047) , fadI (VC1046) , VC1048 , VC1049
    ... ... fadJ fadI VC1048 VC1049
    429 16299312
    NC_002505.1 P0C6C8 dimer ACAAATGATAATAATTTGC +[1337804:1337822] Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) VC1264 , ribA (VC1263) , VC1265 , VC1266 , VC1267
    ... ... VC1264 ribA VC1265 VC1266 VC1267
    429 16299312
    NC_002505.1 P0C6C8 dimer GATAATAATTTGCAATTCA +[1337810:1337828] Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) VC1264 , ribA (VC1263) , VC1265 , VC1266 , VC1267
    ... ... VC1264 ribA VC1265 VC1266 VC1267
    429 16299312
    NC_002505.1 P0C6C8 dimer GTAAATTTGTATTATTTGC +[1337776:1337794] Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) VC1264 , ribA (VC1263)
    ... ... VC1264 ribA
    429 16299312
    NC_002505.1 P0C6C8 dimer TGCAATAAAACCCAATCTC +[1339191:1339209] Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) VC1265 , VC1264 , ribA (VC1263) , VC1266 , VC1267
    ... ... VC1265 VC1264 ribA VC1266 VC1267
    429 16299312
    NC_002505.1 P0C6C8 dimer GTTAATAAATTTAAATCAA +[1674159:1674177] Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) VC1562 , VC1561 , VC1560 , VC1559 , VC1563 , VC1564 , VC1565 , VC1566 , VC1567 , VC1568 , VC1569 , VC1570 , VC1571
    ... ... VC1562 VC1561 VC1560 VC1559 VC1563 VC1564 VC1565 VC1566 VC1567 VC1568 VC1569 VC1570 VC1571
    429 16299312
    NC_002505.1 P0C6C8 dimer ATAAATTTAAATCAATGCT +[1674163:1674181] Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) VC1562 ,