Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00021e10
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
ArgR [UniProtKB:G3XCU2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GGTCGCCTCTGCGACATTCGCTGTCGTGTCCCGGCGTGCCGC - [4413076, 4413117] 15175299 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - 769

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... PA3934
Gene Locus tag Description
PA3934 PA3934 hypothetical protein