Fur regulon and binding site collection in Shewanella piezotolerans WP3

Fur - UniProtKB: B8CQZ2 regulon and binding site collection of Shewanella piezotolerans WP3

Sites are listed as curated.

AAATGAGATTTGTTCTCAAAC
AGATAAGAATAATTATCATTT

Sites are listed after the alignment process. For alignment of variable-length binding sites, LASAGNA is used.

AAATGAGATTTGTTCTCAAAC
AAATGATAATTATTCTTATCT

Motif structure	Inverted repeat
GC-content	21.43%
Regulatory mode	Activation	Repression	Dual	Not specified
Regulatory mode	0%	100%	0%	0%
TF conformation	Monomer	Dimer	Tetramer	Other	Not specified
TF conformation	0%	0%	0%	0%	100%
Binding site type	Motif-associated	Variable-motif-associated	Non-motif-associated
Binding site type	2	0	0

For the selected transcription factor and species, the list of curated binding sites in the database are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation.

Genome	TF	TF conformation	Site sequence	Site location	Experimental techniques	Gene regulation	Curations	PMIDs
NC_011566.1	B8CQZ2	not specified	AAATGAGATTTGTTCTCAAAC	+[3445115:3445135]	Experimental technique details EMSA (ECO:0001807) EMSA - ECO:0001807 Electro-mobility shift-assays (or gel retardation assays) are a standard way of assessing TF-binding. A fragment of DNA of interest is amplified and labeled with a fluorophore. The fragment is left to incubate in a solution containing abundant TF and non-specific DNA (e.g. randomly cleaved DNA from salmon sperm, of all things) and then a gel is run with the incubated sample and a control (sample that has not been in contact with the TF). If the TF has bound the sample, the complex will migrate more slowly than unbound DNA through the gel, and this retarded band can be used as evidence of binding. The unspecific DNA ensures that the binding is specific to the fragment of interest and that any non-specific DNA-binding proteins left-over in the TF purification will bind there, instead of on the fragment of interest. EMSAs are typically carried out in a bunch of fragments, shown as multiple double (control+experiment) lanes in a wide picture. Certain additional controls are run in at least one of the fragments to ascertain specificity. In the most basic of these, specific competitor (the fragment of interest or a known positive control, unlabelled) is added to the reaction. This should sequester the TF and hence make the retardation band disappear, proving that the binding is indeed specific - Experimental technique details qPCR [quantitative real-time] (ECO:0005660) qPCR [quantitative real-time] - ECO:0005660 Quantitative PCR (or quantitative real time polymerase chain reaction) is a modification of the conventional PCR reaction used to amplify and simultaneously quantify a targeted DNA molecule. In its more standard incarnation, a inactive fluorescent dye is added to the PCR mix. This dye is activated upon binding double-stranded DNA; as the PCR iterates, there is more and more dsDNA and therefore more fluorescence intensity. - Experimental technique details RNA-Seq (ECO:0005664) RNA-Seq - ECO:0005664 In RNA-seq, RNA is extracted from the cell at a given time and reverse transcribed to obtain cDNA. This cDNA is then sequenced. This provides a snapshot of the "transcriptome" of an organism at a given time. - Experimental technique details Visual sequence inspection (nan) Visual sequence inspection - nan Visual inspection of promoter region to identify putative binding sites based on previous knowledge	swp_3277	1018	24124499
NC_011566.1	B8CQZ2	not specified	AGATAAGAATAATTATCATTT	+[4672600:4672620]	Experimental technique details EMSA (ECO:0001807) EMSA - ECO:0001807 Electro-mobility shift-assays (or gel retardation assays) are a standard way of assessing TF-binding. A fragment of DNA of interest is amplified and labeled with a fluorophore. The fragment is left to incubate in a solution containing abundant TF and non-specific DNA (e.g. randomly cleaved DNA from salmon sperm, of all things) and then a gel is run with the incubated sample and a control (sample that has not been in contact with the TF). If the TF has bound the sample, the complex will migrate more slowly than unbound DNA through the gel, and this retarded band can be used as evidence of binding. The unspecific DNA ensures that the binding is specific to the fragment of interest and that any non-specific DNA-binding proteins left-over in the TF purification will bind there, instead of on the fragment of interest. EMSAs are typically carried out in a bunch of fragments, shown as multiple double (control+experiment) lanes in a wide picture. Certain additional controls are run in at least one of the fragments to ascertain specificity. In the most basic of these, specific competitor (the fragment of interest or a known positive control, unlabelled) is added to the reaction. This should sequester the TF and hence make the retardation band disappear, proving that the binding is indeed specific - Experimental technique details qPCR [quantitative real-time] (ECO:0005660) qPCR [quantitative real-time] - ECO:0005660 Quantitative PCR (or quantitative real time polymerase chain reaction) is a modification of the conventional PCR reaction used to amplify and simultaneously quantify a targeted DNA molecule. In its more standard incarnation, a inactive fluorescent dye is added to the PCR mix. This dye is activated upon binding double-stranded DNA; as the PCR iterates, there is more and more dsDNA and therefore more fluorescence intensity. - Experimental technique details RNA-Seq (ECO:0005664) RNA-Seq - ECO:0005664 In RNA-seq, RNA is extracted from the cell at a given time and reverse transcribed to obtain cDNA. This cDNA is then sequenced. This provides a snapshot of the "transcriptome" of an organism at a given time. - Experimental technique details Visual sequence inspection (nan) Visual sequence inspection - nan Visual inspection of promoter region to identify putative binding sites based on previous knowledge	swp_4456 , swp_4457 , swp_4458	1018	24124499

All binding sites in split view are combined and a sequence logo is generated. Note that it may contain binding site sequences from different transcription factors and different species. To see individiual sequence logos and curation details go to split view.

Sites are listed as curated.

AAATGAGATTTGTTCTCAAAC
AGATAAGAATAATTATCATTT

Sites are listed after the alignment process. For alignment of variable-length binding sites, LASAGNA is used.

AAATGAGATTTGTTCTCAAAC
AAATGATAATTATTCTTATCT

To generate the weblogo, aligned binding sites are used.

	Download data in FASTA format.
	Download data in TSV (tab-separated-value) format. For each binding site, all sources of evidence (i.e. experimental techniques and publication information) are combined into one record.
	Download raw data in TSV format. All reported sites are exported individually.
	Download data in Attribute-Relation File Format (ARFF).
	Download Position-Specific-Frequency-Matrix of the motif in TRANSFAC format.
	Download Position-Specific-Frequency-Matrix of the motif in JASPAR format.
	Download Position-Specific-Frequency-Matrix of the motif in raw FASTA format. The matrix consists of four columns in the order A C G T.