Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002c990
Genome
Shewanella piezotolerans - NC_011566.1
TF
Fur [UniProtKB:B8CQZ2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AAATGAGATTTGTTCTCAAAC + [3445116, 3445136] 24124499 Experimental technique details EMSA (ECO:0001807) - Experimental technique details qPCR [quantitative real-time] (ECO:0005660) - Experimental technique details RNA-Seq (ECO:0005664) - Experimental technique details Visual sequence inspection (nan) - 1018

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... swp_3277
Gene Locus tag Description
swp_3277 swp_3277 Decaheme cytochrome c