RpoE regulon and binding site collection in Vibrio cholerae O395

RpoE - UniProtKB: Q9KPA6 regulon and binding site collection of Vibrio cholerae O395

Sites are listed as curated.

GGAACTCATTGCCACATTGCCTCTCTAA

Sites are listed after the alignment process. For alignment of variable-length binding sites, LASAGNA is used.

GGAACTCATTGCCACATTGCCTCTCTAA

Motif structure	Direct repeat
GC-content	46.43%
Regulatory mode	Activation	Repression	Dual	Not specified
Regulatory mode	100%	0%	0%	0%
TF conformation	Monomer	Dimer	Tetramer	Other	Not specified
TF conformation	0%	0%	0%	0%	100%
Binding site type	Motif-associated	Variable-motif-associated	Non-motif-associated
Binding site type	1	0	0

For the selected transcription factor and species, the list of curated binding sites in the database are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation.

Genome	TF	TF conformation	Site sequence	Site location	Experimental techniques	Gene regulation	Curations	PMIDs
NC_009457.1	Q9KPA6	not specified	GGAACTCATTGCCACATTGCCTCTCTAA	-[2462239:2462266]	Experimental technique details Luciferase reporter assay (ECO:0005648) Luciferase reporter assay - ECO:0005648 A type of reporter assay . The idea is identical to a betagalactosidase assay, but here fluorescence of luciferase gene product is used as the reporter. - Experimental technique details Visual sequence inspection (nan) Visual sequence inspection - nan Visual inspection of promoter region to identify putative binding sites based on previous knowledge	epsC (VC0395_A2307) , gspD (VC0395_A2306) , epsE (VC0395_A2305) , epsF (VC0395_A2304) , epsG (VC0395_A2303) , epsH (VC0395_A2302) , epsI (VC0395_A2301) , epsJ (VC0395_A2300) , epsK (VC0395_A2299) , epsL (VC0395_A2298) , epsM (VC0395_A2297) , epsN (VC0395_A2296) , hslO (VC0395_A2309)	834	24733097

All binding sites in split view are combined and a sequence logo is generated. Note that it may contain binding site sequences from different transcription factors and different species. To see individiual sequence logos and curation details go to split view.

Sites are listed as curated.

GGAACTCATTGCCACATTGCCTCTCTAA

Sites are listed after the alignment process. For alignment of variable-length binding sites, LASAGNA is used.

GGAACTCATTGCCACATTGCCTCTCTAA

To generate the weblogo, aligned binding sites are used.

	Download data in FASTA format.
	Download data in TSV (tab-separated-value) format. For each binding site, all sources of evidence (i.e. experimental techniques and publication information) are combined into one record.
	Download raw data in TSV format. All reported sites are exported individually.
	Download data in Attribute-Relation File Format (ARFF).
	Download Position-Specific-Frequency-Matrix of the motif in TRANSFAC format.
	Download Position-Specific-Frequency-Matrix of the motif in JASPAR format.
	Download Position-Specific-Frequency-Matrix of the motif in raw FASTA format. The matrix consists of four columns in the order A C G T.