Binding site | Location | Publication | Experimental techniques used | Curation |
---|---|---|---|---|
GGAACTCATTGCCACATTGCCTCTCTAA | - [2462240, 2462267] | 24733097 |
|
834 |
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Gene | Locus tag | Description |
---|---|---|
epsC | VC0395_A2307 | general secretion pathway protein C |
gspD | VC0395_A2306 | general secretion pathway protein D |
epsE | VC0395_A2305 | general secretion pathway protein E |
epsF | VC0395_A2304 | general secretion pathway protein F |
epsG | VC0395_A2303 | general secretion pathway protein G |
epsH | VC0395_A2302 | general secretion pathway protein H |
epsI | VC0395_A2301 | general secretion pathway protein I |
epsJ | VC0395_A2300 | general secretion pathway protein J |
epsK | VC0395_A2299 | general secretion pathway protein K |
epsL | VC0395_A2298 | general secretion pathway protein L |
epsM | VC0395_A2297 | cholera toxin secretion protein EpsM |
epsN | VC0395_A2296 | general secretion pathway protein N |
hslO | VC0395_A2309 | Hsp33-like chaperonin |