Curation Information

Publication
Interaction of two LysR-type regulatory proteins CatR and ClcR with heterologous promoters: functional and evolutionary implications.;Parsek MR, McFall SM, Shinabarger DL, Chakrabarty AM;Proceedings of the National Academy of Sciences of the United States of America 1994 Dec 20; 91(26):12393-7 [7809047]
TF
CatR [F8G324, view regulon]
Reported TF sp.
Pseudomonas putida PRS2000
Reported site sp.
Pseudomonas putida PRS2000
Created by
Matthew Coveyou
Curation notes
ClcABD is born on the Pseudomonas putida plasmid pAC27, which has no RefSeq equivalent.

Experimental Process

DNase I protection of the plasmid (pAC27)-borne clcABD promoter and chromosomal catBC promoter generated a binding footprint for CatR on each. CatR was shown to bind to clcABD without its inducer, though in the presence of the inducer binding affinity was increased. EMSA confirmed binding to both regions. Qualitative growth analysis and beta-gal assay together demonstrated catBC and clcABD activation by catR, with the later being activated even without the inducer.

Transcription Factor Binding Sites


TCCATCAGACCTCCAGGGTATGGTGGGAGATTCATTCGATATTGGACGGC
TCCATCAGACCTCCAGGGTATGGTGGGAGATTCATTCGATATTGGACGGC

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
TCCATCAGACCTCCAGGGTATGGTGGGAGATTCATTCGATATTGGACGGC PPS_3181, PPS_3180,
... ... PPS_3181 PPS_3180 PPS_3182 PPS_3179 PPS_3183
Experimental technique details Ad-hoc qualitative phenotype observation (ECO:0005674) - Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - activator tetramer