CatR - UniProtKB: F8G324 regulon and binding site collection of Pseudomonas putida S16


Sites are listed as curated.

GCAGACCCTTGTGGTATTGCGTGTTC
CTCCATCAGACCTCCAGGGTATGGTGGGAGATTCATTCGATATTGGACGGCTATCAGG
TCCATCAGACCTCCAGGGTATGGTGGGAGATTCATTCGATATTGGACGGC

Sites are listed after the alignment process. For alignment of variable-length binding sites, LASAGNA is used.

GCAGACCCTTGTGGTATTGCGTGTTC

For the selected transcription factor and species, the list of curated binding sites in the database are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation.

    Genome TF TF conformation Site sequence Site location Experimental techniques Gene regulation Curations PMIDs
    NC_015733.1 F8G324 not specified GCAGACCCTTGTGGTATTGCGTGTTC -[3574780:3574805] Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Site directed mutagenesis (ECO:0005667) - Experimental technique details Visual sequence inspection (nan) PPS_3181 , PPS_3180 , PPS_3179 , PPS_3182
    ... ... PPS_3181 PPS_3180 PPS_3179 PPS_3182
    829 9573187
    NC_015733.1 F8G324 tetramer CTCCATCAGACCTCCAGGGTATGGTGGGAGATTCATTCGATATTGGACGGCTATCAGG -[3574981:3575038] Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Premethylation interference footprinting (ECO:0005656) PPS_3181 , PPS_3180 , PPS_3182 , PPS_3179 , PPS_3183
    ... ... PPS_3181 PPS_3180 PPS_3182 PPS_3179 PPS_3183
    805 1447146
    NC_015733.1 F8G324 tetramer TCCATCAGACCTCCAGGGTATGGTGGGAGATTCATTCGATATTGGACGGC -[3574988:3575037] Experimental technique details Ad-hoc qualitative phenotype observation (ECO:0005674) - Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) PPS_3181 , PPS_3180 , PPS_3182 , PPS_3179 , PPS_3183
    ... ... PPS_3181 PPS_3180 PPS_3182 PPS_3179 PPS_3183
    825 7809047

    All binding sites in split view are combined and a sequence logo is generated. Note that it may contain binding site sequences from different transcription factors and different species. To see individiual sequence logos and curation details go to split view.


    Sites are listed as curated.

    GCAGACCCTTGTGGTATTGCGTGTTC
    CTCCATCAGACCTCCAGGGTATGGTGGGAGATTCATTCGATATTGGACGGCTATCAGG
    TCCATCAGACCTCCAGGGTATGGTGGGAGATTCATTCGATATTGGACGGC

    Sites are listed after the alignment process. For alignment of variable-length binding sites, LASAGNA is used.

    GCAGACCCTTGTGGTATTGCGTGTTC
    Download data in FASTA format.
    Download data in TSV (tab-separated-value) format. For each binding site, all sources of evidence (i.e. experimental techniques and publication information) are combined into one record.
    Download raw data in TSV format. All reported sites are exported individually.
    Download data in Attribute-Relation File Format (ARFF).
    Download Position-Specific-Frequency-Matrix of the motif in TRANSFAC format.
    Download Position-Specific-Frequency-Matrix of the motif in JASPAR format.
    Download Position-Specific-Frequency-Matrix of the motif in raw FASTA format. The matrix consists of four columns in the order A C G T.