Curation Information

Publication: Elucidation of the regulon and cis-acting regulatory element of HrpB, the AraC-type regulator of a plant pathogen-like type III secretion system in Burkholderia pseudomallei.;Lipscomb L, Schell MA;Journal of bacteriology 2011 Apr; 193(8):1991-2001 [21335458]
TF: HrpB [A3P7B1, view regulon]
Reported TF sp.: Burkholderia pseudomallei 1026b
Reported site sp.: Burkholderia pseudomallei 1026b
Created by: Erill Lab
Curation notes: -
External databases: ArrayExpress (E-MTAB-484) http://www.ebi.ac.uk/arrayexpress/arrays/E-MTAB-484/.

Experimental Process

RNA-seq was performed on overproducing HrpB strain. HrpB-like sites were identified through multiple sequence alignment of promoters. BPSS1623, BPSS1621, BPSS1614, and BPSS1592 induction in HrpB overproducing strain was verified by RT-PCR. Site directed mutagenesis was performed on the BPSS1606 promoter and its HrpB dependent activity assessed through beta-gal assays.

Transcription Factor Binding Sites

Sites reported in the paper
Sites matched in the genome

TTCGGCTGCCGCGACGCCGCTTCG
TTCGCATCCGGCGGCGCGGCTTCG
TTCGCGTTTCGACTTGCGGCTTCG
TTCGCATCCGGCGCGCGCGCTTCG

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence	Regulated genes	Experimental techniques	TF function	TF type
TTCGGCTGCCGCGACGCCGCTTCG	BP1026B_RS27230,	Experimental technique details Beta-gal reporter assay Beta-gal reporter assay Reporter assay using the beta-galactosidase (lacZ) gene. The lacZ gene is typically fused to the promoter of interest. Differential regulation of the promoter mediated by the TF is assessed by induction of the system and evaluation of lacZ expression. Bacteria expressing lacZ appear blue when grown on a X-gal medium. The assay is often performed using a plasmid borne construction on a lacZ(def) strain. - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) Multiple sequence alignment (MSA) - ECO:0005556 MSA can be used to align promoter regions and highlight regions of conservation that may be indicative of transcription factor binding sites. - Experimental technique details RNA-Seq (ECO:0005664) RNA-Seq - ECO:0005664 In RNA-seq, RNA is extracted from the cell at a given time and reverse transcribed to obtain cDNA. This cDNA is then sequenced. This provides a snapshot of the "transcriptome" of an organism at a given time. - Experimental technique details Site directed mutagenesis (ECO:0005667) Site directed mutagenesis - ECO:0005667 Target-specific mutation, as opposed to non-specific mutation. In the context of TF-binding sites, site-directed mutagenesis is typically used to establish/confirm the specific sequence and location of a site, often in tandem with EMSA. Different positions of a putative binding site are mutated to non-consensus (or random) bases and binding to the mutated site is evaluated through EMSA or other means. Often implemented only in conserved motif positions or serially through all positions of a site. -	activator	not specified
TTCGCATCCGGCGGCGCGGCTTCG	BP1026B_RS27305, BP1026B_RS27310,	Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) Multiple sequence alignment (MSA) - ECO:0005556 MSA can be used to align promoter regions and highlight regions of conservation that may be indicative of transcription factor binding sites. - Experimental technique details qRT-PCR [RNA] (ECO:0001808) qRT-PCR [RNA] - ECO:0001808 Quantitative Reverse-Transcription PCR is a modification of PCR in which RNA is first reverse transcribed into cDNA and this is amplified measuring the product (qPCR) in real time. It therefore allows one to analyze transcription by directly measuring the product (RNA) of a gene's transcription. If the gene is transcribed more, the starting product for PCR is larger and the corresponding volume of amplification is also larger. - Experimental technique details RNA-Seq (ECO:0005664) RNA-Seq - ECO:0005664 In RNA-seq, RNA is extracted from the cell at a given time and reverse transcribed to obtain cDNA. This cDNA is then sequenced. This provides a snapshot of the "transcriptome" of an organism at a given time. -	activator	not specified
TTCGCGTTTCGACTTGCGGCTTCG	BP1026B_RS27290,	Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) Multiple sequence alignment (MSA) - ECO:0005556 MSA can be used to align promoter regions and highlight regions of conservation that may be indicative of transcription factor binding sites. - Experimental technique details RNA-Seq (ECO:0005664) RNA-Seq - ECO:0005664 In RNA-seq, RNA is extracted from the cell at a given time and reverse transcribed to obtain cDNA. This cDNA is then sequenced. This provides a snapshot of the "transcriptome" of an organism at a given time. -	activator	not specified
TTCGCATCCGGCGCGCGCGCTTCG	BP1026B_RS27305,	Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) Multiple sequence alignment (MSA) - ECO:0005556 MSA can be used to align promoter regions and highlight regions of conservation that may be indicative of transcription factor binding sites. - Experimental technique details RNA-Seq (ECO:0005664) RNA-Seq - ECO:0005664 In RNA-seq, RNA is extracted from the cell at a given time and reverse transcribed to obtain cDNA. This cDNA is then sequenced. This provides a snapshot of the "transcriptome" of an organism at a given time. -	activator	not specified