Curation Information

Publication
The regulatory role of ferric uptake regulator (Fur) during anaerobic respiration of Shewanella piezotolerans WP3.;Yang XW, He Y, Xu J, Xiao X, Wang FP;PloS one 2013; 8(10):e75588 [24124499]
TF
Fur [B8CQZ2, view regulon]
Reported TF sp.
Shewanella piezotolerans WP3
Reported site sp.
Shewanella piezotolerans WP3
Created by
Dinara Sagitova
Curation notes
-

Experimental Process

RNA-seq analysis using mRNA from the wild-type and fur mutant strains identified genes regulated by Fur in S. piezotolerans WP3. qPCR validated the RNA-seq results. EMSA confirmed specific binding of Fur to three promoters containing predicted Fur binding sites.

Transcription Factor Binding Sites


AAATGAGATTTGTTCTCAAAC
AGATAAGAATAATTATCATTT
AAATGAGATTTGTTCTCAAAC
AGATAAGAATAATTATCATTT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
AAATGAGATTTGTTCTCAAAC swp_3277
... ... swp_3277
Experimental technique details EMSA (ECO:0001807) - Experimental technique details qPCR [quantitative real-time] (ECO:0005660) - Experimental technique details RNA-Seq (ECO:0005664) - Experimental technique details Visual sequence inspection (nan) - repressor not specified
AGATAAGAATAATTATCATTT swp_4456,
... ... swp_4456 swp_4457 swp_4458
Experimental technique details EMSA (ECO:0001807) - Experimental technique details qPCR [quantitative real-time] (ECO:0005660) - Experimental technique details RNA-Seq (ECO:0005664) - Experimental technique details Visual sequence inspection (nan) - repressor not specified