Curation Information

Publication: The gdhB gene of Pseudomonas aeruginosa encodes an arginine-inducible NAD(+)-dependent glutamate dehydrogenase which is subject to allosteric regulation.;Lu CD, Abdelal AT;Journal of bacteriology 2001 Jan; 183(2):490-9 [11133942]
TF: ArgR [G3XCU2, view regulon]
Reported TF sp.: Pseudomonas aeruginosa PAO1
Reported site sp.: Pseudomonas aeruginosa PAO1
Created by: Grace Chandler
Curation notes: -

Experimental Process

Visual sequence inspection upstream of gdhB revealed a putative ArgR binding site based on similarity to the ArgR consensus. A ghdB::lacZ transcriptional fusion assay using an argR knockout strain demonstrated the role of ArgR as an activator of arginine dependent induction. Multiple sequence alignment deduced an ArgR consensus sequence.

Transcription Factor Binding Sites

Sites reported in the paper
Sites matched in the genome

TGCTCCCGGGGTGAACGAATATGTCGCAGCACGGTAAGTGTT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence	Regulated genes	Gene diagram	Experimental techniques	TF function	TF type
TGCTCCCGGGGTGAACGAATATGTCGCAGCACGGTAAGTGTT	gdhB,		Experimental technique details Beta-gal reporter assay Beta-gal reporter assay Reporter assay using the beta-galactosidase (lacZ) gene. The lacZ gene is typically fused to the promoter of interest. Differential regulation of the promoter mediated by the TF is assessed by induction of the system and evaluation of lacZ expression. Bacteria expressing lacZ appear blue when grown on a X-gal medium. The assay is often performed using a plasmid borne construction on a lacZ(def) strain. - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) Multiple sequence alignment (MSA) - ECO:0005556 MSA can be used to align promoter regions and highlight regions of conservation that may be indicative of transcription factor binding sites. - Experimental technique details Visual sequence inspection (nan) Visual sequence inspection - nan Visual inspection of promoter region to identify putative binding sites based on previous knowledge -	activator	not specified