Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002e4f0
Genome
Pectobacterium carotovorum - NC_018525.1
TF
RdgB [UniProtKB:Q47588, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AATACTTAAACTCCTTTAAAATCATA + [1803921, 1803946] 18689515 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 1134

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... PCC21_015820 PCC21_015830 PCC21_015840 PCC21_015850 PCC21_015860
Gene Locus tag Description
PCC21_015820 PCC21_015820 hypothetical protein
PCC21_015830 PCC21_015830 transglycosylase
PCC21_015840 PCC21_015840 hypothetical protein
PCC21_015850 PCC21_015850 hypothetical protein
PCC21_015860 PCC21_015860 hypothetical protein