Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002e470
Genome
Burkholderia pseudomallei - NC_017832.1
TF
HrpB [UniProtKB:A3P7B1, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTCGCATCCGGCGCGCGCGCTTCG + [2167711, 2167734] 21335458 Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details RNA-Seq (ECO:0005664) - 1129

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... BP1026B_RS27305 BP1026B_RS27300 BP1026B_RS27295 BP1026B_RS27290 ssaR BP1026B_RS27280 BP1026B_RS27275 BP1026B_RS27310 BP1026B_RS27315 BP1026B_RS27320 BP1026B_RS27325 BP1026B_RS27330 fliI BP1026B_RS27340 BP1026B_RS27345
Gene Locus tag Description
BP1026B_RS27305 BP1026B_RS27305 type III secretion system protein HrcU
BP1026B_RS27300 BP1026B_RS27300 EscV/YscV/HrcV family type III secretion system export apparatus protein
BP1026B_RS27295 BP1026B_RS27295 type III secretion protein HpaP
BP1026B_RS27290 BP1026B_RS27290 type III secretion protein
ssaR BP1026B_RS27285 EscR/YscR/HrcR family type III secretion system export apparatus protein
BP1026B_RS27280 BP1026B_RS27280 EscS/YscS/HrcS family type III secretion system export apparatus protein
BP1026B_RS27275 BP1026B_RS27275 hypothetical protein
BP1026B_RS27310 BP1026B_RS27310 type III secretion protein
BP1026B_RS27315 BP1026B_RS27315 type III secretion protein HrpB2
BP1026B_RS27320 BP1026B_RS27320 EscJ/YscJ/HrcJ family type III secretion inner membrane ring protein
BP1026B_RS27325 BP1026B_RS27325 type III secretion protein HrpB4
BP1026B_RS27330 BP1026B_RS27330 type III secretion system protein HrpB
fliI BP1026B_RS27335 EscN/YscN/HrcN family type III secretion system ATPase
BP1026B_RS27340 BP1026B_RS27340 type III secretion protein HrpB7
BP1026B_RS27345 BP1026B_RS27345 EscT/YscT/HrcT family type III secretion system export apparatus protein