Site information for: HrpB in species Burkholderia pseudomallei; genome accession: NC

Transcription Factor Binding Site Information

dbxref: CollecTF:EXPSITE_0002e460
Genome: Burkholderia pseudomallei - NC_017832.1
TF: HrpB [UniProtKB:A3P7B1, view regulon]

Supporting Evidence

Binding site	Location	Publication	Experimental techniques used	Curation
TTCGCGTTTCGACTTGCGGCTTCG	- [2163968, 2163991]	21335458	Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) Multiple sequence alignment (MSA) - ECO:0005556 MSA can be used to align promoter regions and highlight regions of conservation that may be indicative of transcription factor binding sites. - Experimental technique details RNA-Seq (ECO:0005664) RNA-Seq - ECO:0005664 In RNA-seq, RNA is extracted from the cell at a given time and reverse transcribed to obtain cDNA. This cDNA is then sequenced. This provides a snapshot of the "transcriptome" of an organism at a given time. -	1129

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Gene	Locus tag	Description
BP1026B_RS27290	BP1026B_RS27290	type III secretion protein
BP1026B_RS27295	BP1026B_RS27295	type III secretion protein HpaP
ssaR	BP1026B_RS27285	EscR/YscR/HrcR family type III secretion system export apparatus protein
BP1026B_RS27280	BP1026B_RS27280	EscS/YscS/HrcS family type III secretion system export apparatus protein
BP1026B_RS27275	BP1026B_RS27275	hypothetical protein