Site information for: OhrR in species Shewanella oneidensis; genome accession: NC

Transcription Factor Binding Site Information

dbxref: CollecTF:EXPSITE_0002c970
Genome: Shewanella oneidensis - NC_004347.2
TF: OhrR [UniProtKB:Q8EI70, view regulon]

Supporting Evidence

Binding site	Location	Publication	Experimental techniques used	Curation
AATTAGATTGCGTGCAATCTAATT	+ [1007584, 1007607]	25009841	Experimental technique details qRT-PCR [RNA] (ECO:0001808) qRT-PCR [RNA] - ECO:0001808 Quantitative Reverse-Transcription PCR is a modification of PCR in which RNA is first reverse transcribed into cDNA and this is amplified measuring the product (qPCR) in real time. It therefore allows one to analyze transcription by directly measuring the product (RNA) of a gene's transcription. If the gene is transcribed more, the starting product for PCR is larger and the corresponding volume of amplification is also larger. -	1016

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Gene	Locus tag	Description
ohrA	SO_0976	peroxiredoxin OhrA
ohrR	SO_0977	hydroperoxide resistance transcriptional regulator OhrR
glpD	SO_0978	aerobic glycerol-3-phosphate dehydrogenase GlpD