Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000223c0
Genome
Pseudomonas putida - NC_002947.3
TF
CatR [UniProtKB:Q88GK5, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TCCATCAGACCTCCAGGGTATGGT - [4238362, 4238385] 1649820 Experimental technique details Beta-gal reporter assay - Experimental technique details DNA affinity purification (ECO:0005629) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Hydroxyl-radical footprinting (ECO:0005643) - 804

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... catB catC catA catR PP_3712
Gene Locus tag Description
catB PP_3715 muconate and chloromuconate cycloisomerase
catC PP_3714 muconolactone isomerase
catA PP_3713 catechol 1,2-dioxygenase
catR PP_3716 LysR family transcriptional regulator
PP_3712 PP_3712 hypothetical protein