Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0000cc30
Genome
Yersinia pestis - NC_003143.1
TF
CRP [UniProtKB:Q7CFV3, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CTTGTGTGATCAATAGCACACTG + [199441, 199463] 18710863 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details PSSM site search (ECO:0005659) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 558

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... YPO0180 YPO0179 prk YPO0181
Gene Locus tag Description
YPO0180 YPO0180 hydrolase
YPO0179 YPO0179 hypothetical protein
prk YPO0178 phosphoribulokinase 1
YPO0181 YPO0181 ABC transporter