Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00004da0
Genome
Mycobacterium tuberculosis - NC_000962.3
TF
Zur [UniProtKB:P9WN85, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GTTTAATGGCAATCATTTTCAATAAG + [124340, 124365] 17098899 Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 260

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... Rv0106 rpmB1
Gene Locus tag Description
Rv0106 Rv0106 hypothetical protein
rpmB1 Rv0105c 50S ribosomal protein L28-1 RpmB1