Curation Information

Publication
Global analysis of the Mycobacterium tuberculosis Zur (FurB) regulon.;Maciag A, Dainese E, Rodriguez GM, Milano A, Provvedi R, Pasca MR, Smith I, Pal├╣ G, Riccardi G, Manganelli R;Journal of bacteriology 2007 Feb; 189(3):730-40 [17098899]
TF
Zur [P9WN85, view regulon]
Reported TF sp.
Mycobacterium tuberculosis H37Rv
Reported site sp.
Mycobacterium tuberculosis H37Rv
Created by
Dinara Sagitova
Curation notes
-

Experimental Process

DNAse I footprinting was used to identify Zur-binding sites. To validate the binding of Zur to these sites EMSA analysis was performed. Beta-galactosidase reporter assay and qRT-PCR techniques were used to confirm Zur -mediated regulation of identified genes.

Transcription Factor Binding Sites


CCTGTTGAAAATAGTTTTCGACAACC
CTTATTGAAAATCATTTTCGACAACA
CAATAATGAAAACTGTTATCGATAAG
GTTTAATGGCAATCATTTTCAATAAG
CATAATGAAAATCATGTTCAGTAAGC
CCTGTTGAAAATAGTTTTCGACAACC
CTTATTGAAAATCATTTTCGACAACA
CAATAATGAAAACTGTTATCGATAAG
GTTTAATGGCAATCATTTTCAATAAG
CATAATGAAAATCATGTTCAGTAAGC

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
CCTGTTGAAAATAGTTTTCGACAACC rpmB1,
... ... rpmB1 Rv0106
Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - repressor dimer
CTTATTGAAAATCATTTTCGACAACA rpmB2,
... ... rpmB2 rpmG1 rpsN2 rpsR2 Rv2059 Rv2060 Rv2061c
Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - repressor dimer
CAATAATGAAAACTGTTATCGATAAG Rv2059,
... ... Rv2059 rpmB2 rpmG1 rpsN2 rpsR2 Rv2060 Rv2061c
Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - repressor dimer
GTTTAATGGCAATCATTTTCAATAAG Rv0106,
... ... Rv0106 rpmB1
Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - repressor dimer
CATAATGAAAATCATGTTCAGTAAGC PPE3, eccA3,
... ... PPE3 eccA3 Rv0281 eccB3 eccC3 PE5 PPE4 esxG esxH espG3 eccD3 mycP3 eccE3 Rv0293c
Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - repressor dimer