Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00004300
Genome
Escherichia coli - NC_000913.2
TF
MatP [UniProtKB:P0A8N0, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AAAACGTCGCTGCGGTAATGGTGACAGCGTCACTTCCTCCGTTTGGACGTCAG + [1135741, 1135793] 18984159 Experimental technique details ChIP-chip (ECO:0006007) - 168

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... flgI flgH flgJ
Gene Locus tag Description
flgI b1080 predicted flagellar basal body protein
flgH b1079 flagellar protein of basal-body outer-membrane L ring
flgJ b1081 muramidase