IdeR - UniProtKB: I6XF43 regulon and binding site collection of Mycobacterium tuberculosis H37Rv


Sites are listed as curated.

CCGGTTTTTCGCAATCCGG
GATGAACAAAGCAGAG

Sites are listed after the alignment process. For alignment of variable-length binding sites, LASAGNA is used.

CCGGATTGCGAAAAACCGGT
TTGGGATGAACAAAGCAGAG

For the selected transcription factor and species, the list of curated binding sites in the database are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation.

    Genome TF TF conformation Site sequence Site location Experimental techniques Gene regulation Curations PMIDs
    NC_000962.3 I6XF43 not specified CCGGTTTTTCGCAATCCGG +[3343928:3343946] Experimental technique details Consensus search (ECO:0005624) - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) hupB (Rv2986c)
    ... ... hupB
    849 24858079
    NC_000962.3 I6XF43 not specified GATGAACAAAGCAGAG -[3343805:3343820] Experimental technique details Consensus search (ECO:0005624) - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) hupB (Rv2986c)
    ... ... hupB
    849 24858079

    All binding sites in split view are combined and a sequence logo is generated. Note that it may contain binding site sequences from different transcription factors and different species. To see individiual sequence logos and curation details go to split view.


    Sites are listed as curated.

    CCGGTTTTTCGCAATCCGG
    GATGAACAAAGCAGAG

    Sites are listed after the alignment process. For alignment of variable-length binding sites, LASAGNA is used.

    CCGGATTGCGAAAAACCGGT
    TTGGGATGAACAAAGCAGAG
    Download data in FASTA format.
    Download data in TSV (tab-separated-value) format. For each binding site, all sources of evidence (i.e. experimental techniques and publication information) are combined into one record.
    Download raw data in TSV format. All reported sites are exported individually.
    Download data in Attribute-Relation File Format (ARFF).
    Download Position-Specific-Frequency-Matrix of the motif in TRANSFAC format.
    Download Position-Specific-Frequency-Matrix of the motif in JASPAR format.
    Download Position-Specific-Frequency-Matrix of the motif in raw FASTA format. The matrix consists of four columns in the order A C G T.