Western blot analysis and lacZ fusion assays demonstrated auto repression by Rem. These results were validated by growth curve analysis. DNase I footprinting of their promoters revealed a putative Rem binding site. Multiple sequence alignment of this site and other related promoters identified a Rem consensus binding sequence.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
GCGTTAACTTTTCAACATCATGTTAGTGGTAAGGTTAACGATCACCC | rem, |
|
repressor | not specified |