Curation Information

Publication
RovM, a novel LysR-type regulator of the virulence activator gene rovA, controls cell invasion, virulence and motility of Yersinia pseudotuberculosis.;Heroven AK, Dersch P;Molecular microbiology 2006 Dec; 62(5):1469-83 [17074075]
TF
RovM [Q0WF12, view regulon]
Reported TF sp.
Yersinia pseudotuberculosis YPIII
Reported site sp.
Yersinia pseudotuberculosis YPIII
Created by
Grace Chandler
Curation notes
-

Experimental Process

A rovA-lacZ fusion demonstrated repression of rovA by RovM. EMSA showed RovM binding to rovA. DNase I footprinting confirmed this binding and localized the RovM binding site.

Transcription Factor Binding Sites


ATCGTTGATACATCATTTTTTCTAAAGAATTGCT
ATCGTTGATACATCATTTTTTCTAAAGAATTGCT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
ATCGTTGATACATCATTTTTTCTAAAGAATTGCT YPK_1876
... ... YPK_1876
Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - repressor not specified