Curation Information

Publication: OryR is a LuxR-family protein involved in interkingdom signaling between pathogenic Xanthomonas oryzae pv. oryzae and rice.;Ferluga S, Venturi V;Journal of bacteriology 2009 Feb; 191(3):890-7 [19028884]
TF: OryR [Q5H3E9, view regulon]
Reported TF sp.: Xanthomonas oryzae pv. oryzae XKK.12
Reported site sp.: Xanthomonas oryzae pv. oryzae XKK.12
Created by: Dinara Sagitova
Curation notes: -

Experimental Process

Visual sequence inspection identified a well-conserved lux box in the pip promoter region. Comparison of the pip promoter activity in the WT and oryR mutant strains by gus reporter assays confirmed the OryR-dependent activation of pip as no promoter activity was observed in the oryR mutant.

Transcription Factor Binding Sites

Sites reported in the paper
Sites matched in the genome

ACCTGTGAGATTTGCCAGTT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence	Regulated genes	Gene diagram	Experimental techniques	TF function	TF type
ACCTGTGAGATTTGCCAGTT	XOO1269		Experimental technique details GUS reporter gene assay (ECO:0005641) GUS reporter gene assay - ECO:0005641 This is a reporter assay technique, used typically to measure expression of a target gene. A promoter of interest is investigated by fusioning it with the reporter gene, which is then monitored. In GUS, the reporter is the β-glucuronidase enzyme from Escherichia coli, capable of transforming non-fluorescent substates into fluorescent, thereby allowing detection. - Experimental technique details Visual sequence inspection (nan) Visual sequence inspection - nan Visual inspection of promoter region to identify putative binding sites based on previous knowledge -	activator	not specified