Microarray analysis established that in X. oryzae pv oryzae OryR regulated transcription of 330 genes by two-fold or more. qRT-PCR validated the microarray results in a set of 22 genes. The authors closely examined the influence of OryR on the flhF expression. Visual inspection of the flhF promoter identified a lux-box-like sequence. flhF-gus reporter assays in the WT and oryR mutant strains confirmed the OryR-dependent activation of flhF expression.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
ACCTCATGACGCTGGCAACA | flhF, |
|
activator | not specified |