A comparison of sinI mRNA levels in the expR- and expR+ strains showed a 4.3-fold increase, indicating ExpR-mediated activation of sinI by ExpR. EMSA confirmed that ExpR binds specifically to the sinR-sinI intergenic region in the presence of AHL. Footprinting assays showed that ExpR protected a 26-bp region on the sinI promoter. EMSA with subfragments of the sinI-sinR intergenic region confirmed the results obtained from footprinting experiment. Site-directed mutagenesis of the ExpR binding site resulted in the complete absence of binding by ExpR in the presence of oxo-C14-HL.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
ACAAATCTATTGGGAAAAAATGAG | SMc00168 |
|
activator | not specified |