visN-lacZ fusion assays monitored in Rm2011 expR+ and expR- strains revealed that visN expression was 3-fold higher in the expR- than in the AHL-producing expR+ strain. EMSA performed with visN promoter fragments of various length identified a 35-bp fragment that contains an ExpR binding site. This binding site was shown to be homologous to other known ExpR binding sites.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
AACGGGACGCCCTGTCTTTTTG | visN |
|
repressor | not specified |