Curation Information

Publication
Sinorhizobium meliloti regulator MucR couples exopolysaccharide synthesis and motility.;Bahlawane C, McIntosh M, Krol E, Becker A;Molecular plant-microbe interactions : MPMI 2008 Nov; 21(11):1498-509 [18842098]
TF
ExpR [Q92L12, view regulon]
Reported TF sp.
Sinorhizobium meliloti 2011
Reported site sp.
Sinorhizobium meliloti 2011
Created by
Dinara Sagitova
Curation notes
-

Experimental Process

visN-lacZ fusion assays monitored in Rm2011 expR+ and expR- strains revealed that visN expression was 3-fold higher in the expR- than in the AHL-producing expR+ strain. EMSA performed with visN promoter fragments of various length identified a 35-bp fragment that contains an ExpR binding site. This binding site was shown to be homologous to other known ExpR binding sites.

Transcription Factor Binding Sites


AACGGGACGCCCTGTCTTTTTG
AACGGGACGCCCTGTCTTTTTG

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
AACGGGACGCCCTGTCTTTTTG visN
... ... visN
Experimental technique details Beta-gal reporter assay - Experimental technique details EMSA (ECO:0001807) - repressor not specified