Curation Information

Publication
The glycolytic genes pfk and pyk from Lactobacillus casei are induced by sugars transported by the phosphoenolpyruvate:sugar phosphotransferase system and repressed by CcpA.;Viana R, Pérez-Martínez G, Deutscher J, Monedero V;Archives of microbiology 2005 Sep; 183(6):385-93 [16075200]
TF
CcpA [Q03AX7, view regulon]
Reported TF sp.
Lactobacillus casei BL23
Reported site sp.
Lactobacillus casei BL23
Created by
Dinara Sagitova
Curation notes
-

Experimental Process

Northern blot analysis with mRNA obtained from the wild-type strain BL23 and ccpA mutant strain showed that pfk-pyk expression is repressed by CcpA. EMSA confirmed that CcpA bound to the pfk-pyk intergenic region. DNAse I footprinting showed that CcpA protected a region containing two degenerate CcpA motifs.

Transcription Factor Binding Sites


GTAAAATGTTCTCATTTTCAGGGACTTTGTTTCTGAAAAGTG
GTAAAATGTTCTCATTTTCAGGGACTTTGTTTCTGAAAAGTG

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type