Curation Information

Publication

The repressor for an organic peroxide-inducible operon is uniquely regulated at multiple levels.;Mongkolsuk S, Panmanee W, Atichartpongkul S, Vattanaviboon P, Whangsuk W, Fuangthong M, Eiamphungporn W, Sukchawalit R, Utamapongchai S;Molecular microbiology 2002 May; 44(3):793-802 [11994159]

TF

OhrR [M4TR54, view regulon]

Reported TF sp.

Xanthomonas campestris pv. phaseoli

Reported site sp.

Xanthomonas campestris pv. phaseoli

Created by

Grace Chandler

Curation notes

TTGCAATTAGATCGTGCACTATATAAATTGCAA

Experimental Process

A CAT reporter assay determined the role of OhrR as an autorepressor. EMSA demonstrated binding of OhrR to the P1 promoter upstream of the ohrR transcriptional start site. DNase I footprintinglocalized the binding site in the promoter of interest. Site-directed mutagenesis of this site, in conjunction with CAT reporter assays further specified the identity of the OhrR binding site.

Transcription Factor Binding Sites

• Sites reported in the paper
• Sites matched in the genome

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.