Lux reporter assays showed repression of chromosomal hapR by plasmid-borne HapR. RACE PCR was used to determine the transcription start site. Binding of purified HapR to its promoter was demonstrated with EMSA, using multiple fragment sizes, and further corroborated with DNAse footprinting to define the site, identified by similarity to known motif. Site directed mutagenesis was used to identify mutations that prevent binding.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
CAAATAACAAAATAATCATTAG | VCD_001025, |
|
repressor | not specified |