Curation Information

Publication
The novel transcriptional regulator SczA mediates protection against Zn2+ stress by activation of the Zn2+-resistance gene czcD in Streptococcus pneumoniae.;Kloosterman TG, van der Kooi-Pol MM, Bijlsma JJ, Kuipers OP;Molecular microbiology 2007 Aug; 65(4):1049-63 [17640279]
TF
SczA [Q8DNK2, view regulon]
Reported TF sp.
Streptococcus pneumoniae R6
Reported site sp.
Streptococcus pneumoniae R6
Created by
Matthew Coveyou
Curation notes
-

Experimental Process

Random mutagenesis was used to screen from mutants deficient in Zn2+ dependent induction of a lacZ-fused czcD gene. This revealed the relevance of gene spr1673, named here SczA. Microarray assays of sczA mutants identified affected genes, including czcD. Multiple sequence alignment of the czcD promoter region of several streptococcus species identified a conserved region as a putative binding site (motif 1), and visual inspection identified a second putative site downstream of the first (motif 2). Beta-gal assays of promoter fragments demonstrated dependence on motif 1 for czcD activation, and point mutations of both sites confirmed motif 1 was involved in activation and suggested motif 2 was involved in repression. Motif 2 was also demonstrated to act as an autorepressor binding site for sczA. DNase I protection showed binding to motif 1 only in the presence of Zn2+ and binding to motif 2 only in the absence of Zn2+.

Transcription Factor Binding Sites


GGACACTTAAGGCAAATTGTTCAGAACTGAATA
TGAACAAGGTGTTCA
GGACACTTAAGGCAAATTGTTCAGAACTGAATA
TGAACAAGGTGTTCA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
GGACACTTAAGGCAAATTGTTCAGAACTGAATA czcD,
... ... czcD spr1673
Experimental technique details Beta-gal reporter assay - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details Site directed mutagenesis (ECO:0005667) - activator not specified
TGAACAAGGTGTTCA czcD, spr1673
... ... czcD spr1673
Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Site directed mutagenesis (ECO:0005667) - Experimental technique details Visual sequence inspection (nan) - repressor not specified