Random mutagenesis was used to screen from mutants deficient in Zn2+ dependent induction of a lacZ-fused czcD gene. This revealed the relevance of gene spr1673, named here SczA. Microarray assays of sczA mutants identified affected genes, including czcD. Multiple sequence alignment of the czcD promoter region of several streptococcus species identified a conserved region as a putative binding site (motif 1), and visual inspection identified a second putative site downstream of the first (motif 2). Beta-gal assays of promoter fragments demonstrated dependence on motif 1 for czcD activation, and point mutations of both sites confirmed motif 1 was involved in activation and suggested motif 2 was involved in repression. Motif 2 was also demonstrated to act as an autorepressor binding site for sczA. DNase I protection showed binding to motif 1 only in the presence of Zn2+ and binding to motif 2 only in the absence of Zn2+.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
GGACACTTAAGGCAAATTGTTCAGAACTGAATA | czcD, |
|
activator | not specified | |
TGAACAAGGTGTTCA | czcD, spr1673 |
|
repressor | not specified |