Curation Information

Publication
Quorum sensing in Vibrio fischeri: elements of the luxl promoter.;Egland KA, Greenberg EP;Molecular microbiology 1999 Feb; 31(4):1197-204 [10096086]
TF
LuxR [B5EV73, view regulon]
Reported TF sp.
Vibrio fischeri MJ215
Reported site sp.
Vibrio fischeri MJ215
Created by
Dinara Sagitova
Curation notes
-

Experimental Process

Primer extension analysis established the transcription start site of the lux operon. The authors identified a putative LuxR binding site centred at -42.5 with respect to the start of luxI transcription. Mutagenesis of this lux box showed that a wild-type lux box was necessary for luxI induction since mutations in the lux box resulted in significant decrease of luminescence.

Transcription Factor Binding Sites


ACCTGTAGGATCGTACAGGT
ACCTGTAGGATCGTACAGGT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type