qRT-PCR determined that RovS represses fbsA and that RovS also activates gbs0230, rogB, sodA, and the cyl operon. lacZ reporter assays confirmed the results in vivo. Evidence from site directed mutagenesis and EMSA confirmed the importance of the proposed palindrome for the binding of RovS to the fbsA promoter. EMSA showed that RovS binds directly to fbsA, gbs0230, rogB, sodA, and the cyl operon. Subsequent EMSA testing with different fragment lengths showed the actual binding sites. The promoter regions of these genes were aligned and MSA specifically identified RovS binding sites.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
ATAATATTAAAGGAAAATTTAAAAATAT | gbs1087 |
|
repressor | dimer | |
ATAAAAATGAAGCTAAAAATGATAAGTAT | gbs0230, |
|
activator | dimer | |
AAAATCCTAATCGCTTCTTTTAAAAAAG | sod, |
|
activator | dimer | |
ATAATGTTTATTTTAAATTTAAACTAAT | cylX, cylD, cylG, acpC, gbs0648, cylA, cylB, cylE, cylF, cylI, cylJ, cylK, |
|
activator | dimer |