Curation Information

Publication
The transcriptional regulator RovS controls the attachment of Streptococcus agalactiae to human epithelial cells and the expression of virulence genes.;Samen UM, Eikmanns BJ, Reinscheid DJ;Infection and immunity 2006 Oct; 74(10):5625-35 [16988238]
TF
RovS [Q8E7C5, view regulon]
Reported TF sp.
Streptococcus agalactiae 6313
Reported site sp.
Streptococcus agalactiae 6313
Created by
Joe Sparenberg
Curation notes
-

Experimental Process

qRT-PCR determined that RovS represses fbsA and that RovS also activates gbs0230, rogB, sodA, and the cyl operon. lacZ reporter assays confirmed the results in vivo. Evidence from site directed mutagenesis and EMSA confirmed the importance of the proposed palindrome for the binding of RovS to the fbsA promoter. EMSA showed that RovS binds directly to fbsA, gbs0230, rogB, sodA, and the cyl operon. Subsequent EMSA testing with different fragment lengths showed the actual binding sites. The promoter regions of these genes were aligned and MSA specifically identified RovS binding sites.

Transcription Factor Binding Sites


ATAATATTAAAGGAAAATTTAAAAATAT
ATAAAAATGAAGCTAAAAATGATAAGTAT
AAAATCCTAATCGCTTCTTTTAAAAAAG
ATAATGTTTATTTTAAATTTAAACTAAT
ATAATATTAAAGGAAAATTTAAAAATAT
ATAAAAATGAAGCTAAAAATGATAAGTAT
AAAATCCTAATCGCTTCTTTTAAAAAAG
ATAATGTTTATTTTAAATTTAAACTAAT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
ATAATATTAAAGGAAAATTTAAAAATAT gbs1087
... ... gbs1087
Experimental technique details Beta-gal reporter assay - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - Experimental technique details Site directed mutagenesis (ECO:0005667) - repressor dimer
ATAAAAATGAAGCTAAAAATGATAAGTAT gbs0230,
... ... gbs0230 gbs0231
Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - activator dimer
AAAATCCTAATCGCTTCTTTTAAAAAAG sod,
... ... sod holA
Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - activator dimer
ATAATGTTTATTTTAAATTTAAACTAAT cylX, cylD, cylG, acpC, gbs0648, cylA, cylB, cylE, cylF, cylI, cylJ, cylK,
... ... cylX cylD cylG acpC gbs0648 cylA cylB cylE cylF cylI cylJ cylK gbs0656 gbs0657 gbs0658
Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - activator dimer