Two inverted repeats in the intergenic region of pepO and fimC were identified as potential binding sites by visual sequence inspection. CAT reporter assays showed that FimR represses the fim operon. EMSA confirmed that FirmR bound to the fim operon promoter region. ChIP-qPCR verified that FimR bound to fim promoter in vivo.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
TATTTATGTATATTAATA | tpx, fimA, fimB, fimC, |
|
repressor | not specified | |
TAAATTAACTTGACTTAATTTT | tpx, fimA, fimB, fimC, |
|
repressor | not specified |