Putative LuxR binding sites were identified in the qrr4 and qrgB promoters by searching V. harveyi genome with a LuxR consensus sequence. qrr4-gfp promoter fusion confirmed that LuxR activated qrr4 expression. EMSA confirmed that LuxR bound to the promoter regions of qrr4 and qrgB. Site-directed mutagenesis of the putative LuxR binding sites in conjunction with the fluorescence anisotropy experiments confirmed binding of LuxR to these promoters.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
TATTGAGTTCACAATCAATAC | VIBHAR_00176, |
|
repressor | not specified | |
TTCTGATAAATGTATTAGTAG | VIBHAR_06697, |
|
activator | not specified |