Curation Information

Publication
The Vibrio harveyi master quorum-sensing regulator, LuxR, a TetR-type protein is both an activator and a repressor: DNA recognition and binding specificity at target promoters.;Pompeani AJ, Irgon JJ, Berger MF, Bulyk ML, Wingreen NS, Bassler BL;Molecular microbiology 2008 Oct; 70(1):76-88 [18681939]
TF
LuxR [A7MXJ7, view regulon]
Reported TF sp.
Vibrio harveyi BB120
Reported site sp.
Vibrio harveyi BB120
Created by
Dinara Sagitova
Curation notes
-

Experimental Process

Putative LuxR binding sites were identified in the qrr4 and qrgB promoters by searching V. harveyi genome with a LuxR consensus sequence. qrr4-gfp promoter fusion confirmed that LuxR activated qrr4 expression. EMSA confirmed that LuxR bound to the promoter regions of qrr4 and qrgB. Site-directed mutagenesis of the putative LuxR binding sites in conjunction with the fluorescence anisotropy experiments confirmed binding of LuxR to these promoters.

Transcription Factor Binding Sites


TATTGAGTTCACAATCAATAC
TTCTGATAAATGTATTAGTAG
TATTGAGTTCACAATCAATAC
TTCTGATAAATGTATTAGTAG

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
TATTGAGTTCACAATCAATAC VIBHAR_00176,
... ... VIBHAR_00176 fis VIBHAR_00177 VIBHAR_00178
Experimental technique details EMSA (ECO:0001807) - Experimental technique details Fluorescence anisotropy (ECO:0005632) - Experimental technique details GFP Promoter Fusion (ECO:0005636) - Experimental technique details PSSM site search (ECO:0005659) - Experimental technique details Site directed mutagenesis (ECO:0005667) - repressor not specified
TTCTGATAAATGTATTAGTAG VIBHAR_06697,
... ... VIBHAR_06697 VIBHAR_06698
Experimental technique details EMSA (ECO:0001807) - Experimental technique details Fluorescence anisotropy (ECO:0005632) - Experimental technique details GFP Promoter Fusion (ECO:0005636) - Experimental technique details PSSM site search (ECO:0005659) - Experimental technique details Site directed mutagenesis (ECO:0005667) - activator not specified