Curation Information

Publication
Vibrio vulnificus rpoS expression is repressed by direct binding of cAMP-cAMP receptor protein complex to its two promoter regions.;Lee HJ, Park SJ, Choi SH, Lee KH;The Journal of biological chemistry 2008 Nov 7; 283(45):30438-50 [18713737]
TF
CRP [Q7M7I9, view regulon]
Reported TF sp.
Vibrio vulnificus ATCC 29307
Reported site sp.
Vibrio vulnificus ATCC 29307
Created by
Dinara Sagitova
Curation notes
Less than 90% of the reported sites were located as exact matches.

Experimental Process

rpoS-luxAB fusions in the crp mutant and the wild-type strains showed that there was a 3-fold increase in the rpoS expression in the absence of CRP. Western blot analysis confirmed that more RpoS proteins were observed in the crp mutant strain than in the wild type. EMSA confirmed specific binding of the cAMP-CRP complex to the rpos promoter. Site-directed mutagenesis was used to introduce mutations into the putative CRP binding sites. Alteration of these putative CRP-binding sites resulted in the disappearance of specific interaction with the cAMP-CRP complex in vitro and abolishment of transcriptional repression by the cAMP-CRP complex in vivo.

Transcription Factor Binding Sites


AAATGTTAAACCTGTCACTTCGC
AACTTTGAAACAACTTGCGACAC
AAATGTTAAACCTGTCACTTCAC
AACTTTGAAACAACTTGCGACAC

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
AAATGTTAAACCTGTCACTTCAC VV2808,
... ... VV2808 VV2810 VV2809
Experimental technique details EMSA (ECO:0001807) - Experimental technique details In-vitro transcription (ECO:0001204) - Experimental technique details Luciferase reporter assay (ECO:0005648) - Experimental technique details Site directed mutagenesis (ECO:0005667) - Experimental technique details Western blot (quantitative) expression analysis (ECO:0000279) - repressor not specified
AACTTTGAAACAACTTGCGACAC VV2808
... ... VV2808
Experimental technique details EMSA (ECO:0001807) - Experimental technique details In-vitro transcription (ECO:0001204) - Experimental technique details Luciferase reporter assay (ECO:0005648) - Experimental technique details Site directed mutagenesis (ECO:0005667) - Experimental technique details Western blot (quantitative) expression analysis (ECO:0000279) - repressor not specified