rpoS-luxAB fusions in the crp mutant and the wild-type strains showed that there was a 3-fold increase in the rpoS expression in the absence of CRP. Western blot analysis confirmed that more RpoS proteins were observed in the crp mutant strain than in the wild type. EMSA confirmed specific binding of the cAMP-CRP complex to the rpos promoter. Site-directed mutagenesis was used to introduce mutations into the putative CRP binding sites. Alteration of these putative CRP-binding sites resulted in the disappearance of specific interaction with the cAMP-CRP complex in vitro and abolishment of transcriptional repression by the cAMP-CRP complex in vivo.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
AAATGTTAAACCTGTCACTTCAC | VV2808, |
|
repressor | not specified | |
AACTTTGAAACAACTTGCGACAC | VV2808 |
|
repressor | not specified |