Curation Information

Publication: Expression of the cpdA gene, encoding a 3',5'-cyclic AMP (cAMP) phosphodiesterase, is positively regulated by the cAMP-cAMP receptor protein complex.;Kim HS, Kim SM, Lee HJ, Park SJ, Lee KH;Journal of bacteriology 2009 Feb; 191(3):922-30 [19028903]
TF: CRP [Q7M7I9, view regulon]
Reported TF sp.: Vibrio vulnificus ATCC 29307
Reported site sp.: Vibrio vulnificus ATCC 29307
Created by: Dinara Sagitova
Curation notes: -

Experimental Process

The transcription start site for the mutT-yqiB-cpdA-yqiA operon was determined by primer extension. Visual inspection identified the presence of the CRP consensus in the cpdA promoter region. cpdA-luxAB transcriptional fusion showed that cdpA expression decreased in the crp mutant strain compared to the wild-type strain. EMSA showed that CRP bound specifically to the cpdA promoter. Site-directed mutagenesis of the CRP-binding site in conjunction with EMSA confirmed that cpdA expression is activated by cAMP-CRP acting on the region between positions −106 and −85 relative to its transcription start site.

Transcription Factor Binding Sites

Sites reported in the paper
Sites matched in the genome

AGTTGTGCAATAAATGAATTGT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence	Regulated genes	Gene diagram	Experimental techniques	TF function	TF type
AGTTGTGCAATAAATGAATTGT	VV0584, VV0585, VV0586, VV0587,		Experimental technique details EMSA (ECO:0001807) EMSA - ECO:0001807 Electro-mobility shift-assays (or gel retardation assays) are a standard way of assessing TF-binding. A fragment of DNA of interest is amplified and labeled with a fluorophore. The fragment is left to incubate in a solution containing abundant TF and non-specific DNA (e.g. randomly cleaved DNA from salmon sperm, of all things) and then a gel is run with the incubated sample and a control (sample that has not been in contact with the TF). If the TF has bound the sample, the complex will migrate more slowly than unbound DNA through the gel, and this retarded band can be used as evidence of binding. The unspecific DNA ensures that the binding is specific to the fragment of interest and that any non-specific DNA-binding proteins left-over in the TF purification will bind there, instead of on the fragment of interest. EMSAs are typically carried out in a bunch of fragments, shown as multiple double (control+experiment) lanes in a wide picture. Certain additional controls are run in at least one of the fragments to ascertain specificity. In the most basic of these, specific competitor (the fragment of interest or a known positive control, unlabelled) is added to the reaction. This should sequester the TF and hence make the retardation band disappear, proving that the binding is indeed specific - Experimental technique details Luciferase reporter assay (ECO:0005648) Luciferase reporter assay - ECO:0005648 A type of reporter assay . The idea is identical to a betagalactosidase assay, but here fluorescence of luciferase gene product is used as the reporter. - Experimental technique details Site directed mutagenesis (ECO:0005667) Site directed mutagenesis - ECO:0005667 Target-specific mutation, as opposed to non-specific mutation. In the context of TF-binding sites, site-directed mutagenesis is typically used to establish/confirm the specific sequence and location of a site, often in tandem with EMSA. Different positions of a putative binding site are mutated to non-consensus (or random) bases and binding to the mutated site is evaluated through EMSA or other means. Often implemented only in conserved motif positions or serially through all positions of a site. - Experimental technique details Visual sequence inspection (nan) Visual sequence inspection - nan Visual inspection of promoter region to identify putative binding sites based on previous knowledge -	activator	not specified