Curation Information

Publication
Coactivation of Vibrio vulnificus putAP operon by cAMP receptor protein and PutR through cooperative binding to overlapping sites.;Lee JH, Choi SH;Molecular microbiology 2006 Apr; 60(2):513-24 [16573699]
TF
CRP [Q7M7I9, view regulon]
Reported TF sp.
Vibrio vulnificus ATCC 29307
Reported site sp.
Vibrio vulnificus ATCC 29307
Created by
Dinara Sagitova
Curation notes
-

Experimental Process

Primer extension assay performed with the wild-type and crp mutant strains showed that putAP expression was significantly decreased in the crp mutant. EMSA showed that CRP binds to the putAP promoter. DNase I footprinting assay revealed that CRP protected two regions in the putAP promoter which extended from -103 to -79 and from -143 to -122. put–luxAB transcriptional fusions confirmed that putAP expression was CRP-dependent.

Transcription Factor Binding Sites


TTAAATAAGTTGCTTTTTACGA
TTCGTGTGATCATGTAGTTGTTTT
TTAAATAAGTTGCTTTTTACGA
TTCGTGTGATCATGTAGTTGTTTT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
TTAAATAAGTTGCTTTTTACGA VVA1644,
... ... VVA1644 VVA1645 VVA1643 VVA1642 VVA1641 VVA1640
Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Luciferase reporter assay (ECO:0005648) - Experimental technique details Primer Extension assay (ECO:0005657) - activator not specified
TTCGTGTGATCATGTAGTTGTTTT VVA1644,
... ... VVA1644 VVA1643 VVA1642 VVA1641 VVA1640
Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Luciferase reporter assay (ECO:0005648) - Experimental technique details Primer Extension assay (ECO:0005657) - activator not specified