Primer extension assay performed with the wild-type and crp mutant strains showed that putAP expression was significantly decreased in the crp mutant. EMSA showed that CRP binds to the putAP promoter. DNase I footprinting assay revealed that CRP protected two regions in the putAP promoter which extended from -103 to -79 and from -143 to -122. put–luxAB transcriptional fusions confirmed that putAP expression was CRP-dependent.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
TTAAATAAGTTGCTTTTTACGA | VVA1644, |
|
activator | not specified | |
TTCGTGTGATCATGTAGTTGTTTT | VVA1644, |
|
activator | not specified |