Curation Information

Publication
CRP regulates pheromone-mediated bioluminescence at multiple levels in Vibrio fischeri ES114.;Lyell NL, Colton DM, Bose JL, Tumen-Velasquez MP, Kimbrough JH, Stabb EV;Journal of bacteriology 2013 Aug 30; (): [23995643]
TF
CRP [Q5E2H1, view regulon]
Reported TF sp.
Vibrio fischeri ES114
Reported site sp.
Vibrio fischeri ES114
Created by
Dinara Sagitova
Curation notes
-

Experimental Process

Virtual Footprint program identified a putative CRP binding site in the promoter regions of luxR and ainS genes. luxR-gfp and ainS-gfp reporter assays showed that a 15 and 10 fold decrease in fluorescence in the crp mutant compared to the wild type strain. Quantitative real-time PCR showed that luxR and ainS transcript level was decreased by 250- and 7- fold, repctively, in the crp mutant strain compared to the wild type V. fischeri ES114. Fluorescence polarization DNA binding assays confirmed that CRP binds upstream of luxR and ainS.

Transcription Factor Binding Sites


AATTCGATCTGGGTCACATTT
ATTATGAAAAACTTCACACTT
AATTCGATCTGGGTCACATTT
ATTATGAAAAACTTCACACTT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
AATTCGATCTGGGTCACATTT luxR,
... ... luxR luxI luxC luxD luxA luxB luxE fre
Experimental technique details Fluorescence anisotropy (ECO:0005632) - Experimental technique details GFP Promoter Fusion (ECO:0005636) - Experimental technique details PSSM site search (ECO:0005659) - Experimental technique details qPCR [quantitative real-time] (ECO:0005660) - activator not specified
ATTATGAAAAACTTCACACTT ainS,
... ... ainS ainR rluB
Experimental technique details Fluorescence anisotropy (ECO:0005632) - Experimental technique details GFP Promoter Fusion (ECO:0005636) - Experimental technique details PSSM site search (ECO:0005659) - Experimental technique details qPCR [quantitative real-time] (ECO:0005660) - activator not specified