Curation Information

Publication
The LuxR-type regulator VpsT negatively controls the transcription of rpoS, encoding the general stress response regulator, in Vibrio cholerae biofilms.;Wang H, Ayala JC, Benitez JA, Silva AJ;Journal of bacteriology 2014 Mar; 196(5):1020-30 [24363348]
TF
VpsT [A0A0H3Q9Z3, view regulon]
Reported TF sp.
Vibrio cholerae C7258
Reported site sp.
Vibrio cholerae C7258
Created by
Dinara Sagitova
Curation notes
-

Experimental Process

EMSA confirmed that VpsT binds to the rpoS promoter in the presence of c-di-GMP. ChIP assay showed that VpsT-FLAG can bind the rpoS promoter in vivo. An rpoS transcription start site was determined by primer extension analysis. DNase I footprinting identified the VpsT-protected region in the rpoS promoter. An rpoS-luxCDABE promoter fusion assays showed that expression of rpoS in the vpsT mutant was elevated compared to its wild type strain.

Transcription Factor Binding Sites


TAAGGTCATACTGCAAAGGTTGT
TAAGGTCATACTGCAAAGGTTGT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type