EMSA showed that SmcR binds specifically to the flhF promoter region. DNase I footprinting analysis showed that SmcR protected a region in the flhF promoter that contains a sequence similar to the SmcR consensus. Primer extension analysis and qRT-PCR confirmed that SmcR represses flhF expression.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
TAACTGATCTATTAATTAATAA | VVMO6_00833, |
|
repressor | not specified |