Curation Information

Publication
Evidence that the Vibrio vulnificus flagellar regulator FlhF is regulated by a quorum sensing master regulator SmcR.;Kim SM, Lee DH, Choi SH;Microbiology (Reading, England) 2012 Aug; 158(Pt 8):2017-25 [22679105]
TF
SmcR [Q7ME71, view regulon]
Reported TF sp.
Vibrio vulnificus MO6-24/O
Reported site sp.
Vibrio vulnificus MO6-24/O
Created by
Dinara Sagitova
Curation notes
-

Experimental Process

EMSA showed that SmcR binds specifically to the flhF promoter region. DNase I footprinting analysis showed that SmcR protected a region in the flhF promoter that contains a sequence similar to the SmcR consensus. Primer extension analysis and qRT-PCR confirmed that SmcR represses flhF expression.

Transcription Factor Binding Sites


TAACTGATCTATTAATTAATAA
TAACTGATCTATTAATTAATAA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
TAACTGATCTATTAATTAATAA VVMO6_00833,
... ... VVMO6_00833 VVMO6_00832 VVMO6_00834 VVMO6_00835 VVMO6_00836 VVMO6_00837 VVMO6_00838 VVMO6_00839 VVMO6_00840 VVMO6_00841 VVMO6_00842 VVMO6_00843
Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Primer Extension assay (ECO:0005657) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - Experimental technique details Visual sequence inspection (nan) - repressor not specified