A putative sigma-E binding site that had one mismatch with the V.cholerae and E.coli sigma-E consensus was identified in the eps regulatory region. rpoEP2-lux promoter fusion showed that s iron starvation and exposure to polymyxin B resulted in 4- and 6-fold increases, respectively, in transcriptional activity. esp-lux fusion with an esp promoter that lacked a putative sigma-E binding site showed that RpoE had no effect on the expression compared to the wild type promoter fusion in which overexpression of RpoE resulted in over 4-fold induction of the esp expression. The immunoblotting analyses showed that RpoE positively regulated the expression of T2S at the protein level. Peps-lux fusion assays in wild type O395 and the rpoE mutant strains showed that there was a statistically significant 2-fold induction of eps-lux activity in the wild-type V. cholerae.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
GGAACTCATTGCCACATTGCCTCTCTAA | epsC, |
|
activator | not specified |