Beta-gal assay indicated an intact clcA gene was necessary for activation of the clcAB operon, suggesting clcA coded the enzyme responsible for synthesizing the clcR inducer. In-vivo transcription confirmed this. DNase I protection identified the putative clcR binding site.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
AAGCCATACCGATCCCGTATTGCAAAGGCTAAAAAAAGGTATTGGACC | clcA, |
|
activator | not specified |