Curation Information

Publication: The effect of specific rhlAlas-box mutations on DNA binding and gene activation by Pseudomonas aeruginosa quorum-sensing transcriptional regulators RhlR and LasR.;González-Valdez A, Servín-González L, Juárez K, Hernández EA, Soberón-Chávez G;FEMS microbiology letters 2014 Jun 16; 1(1):1 [24935161]
TF: LasR [P54292, view regulon]
Reported TF sp.: Pseudomonas aeruginosa PAO1
Reported site sp.: Pseudomonas aeruginosa PAO1
Created by: Dinara Sagitova
Curation notes: -

Experimental Process

Site-directed mutagenesis combined with promoter-lacZ fusion assays confirmed RhlR-mediated activation in P.aeruginosa PAO1.

Transcription Factor Binding Sites

Sites reported in the paper
Sites matched in the genome

TCCTGTGAAATCTGGCAGTT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence	Regulated genes	Gene diagram	Experimental techniques	TF function	TF type
TCCTGTGAAATCTGGCAGTT	rhlA,		Experimental technique details Beta-gal reporter assay Beta-gal reporter assay Reporter assay using the beta-galactosidase (lacZ) gene. The lacZ gene is typically fused to the promoter of interest. Differential regulation of the promoter mediated by the TF is assessed by induction of the system and evaluation of lacZ expression. Bacteria expressing lacZ appear blue when grown on a X-gal medium. The assay is often performed using a plasmid borne construction on a lacZ(def) strain. - Experimental technique details Site directed mutagenesis (ECO:0005667) Site directed mutagenesis - ECO:0005667 Target-specific mutation, as opposed to non-specific mutation. In the context of TF-binding sites, site-directed mutagenesis is typically used to establish/confirm the specific sequence and location of a site, often in tandem with EMSA. Different positions of a putative binding site are mutated to non-consensus (or random) bases and binding to the mutated site is evaluated through EMSA or other means. Often implemented only in conserved motif positions or serially through all positions of a site. -	activator	not specified