Site-directed mutagenesis with lacZ reporter assays confirmed AtzR-dependent activation of atzD. In vitro transcription assays showed cyanuric acid is sufficient to induce AtzR-dependent activation of atzD. EMSAs confirmed specific binding of AtzR to the atzD promoter.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
GGTGCCGGATCGGCACCAGTTAGGTCGGAAAAAGGCGGCAGTCAAGTGCG | atzD, |
|
activator | tetramer |