Curation Information

Publication
An A-tract at the AtzR binding site assists DNA binding, inducer-dependent repositioning and transcriptional activation of the PatzDEF promoter.;Porrúa O, López-Sánchez A, Platero AI, Santero E, Shingler V, Govantes F;Molecular microbiology 2013 Oct; 90(1):72-87 [23906008]
TF
AtzR [Q936X4, view regulon]
Reported TF sp.
Pseudomonas sp. ADP
Reported site sp.
Pseudomonas sp. ADP
Created by
Dinara Sagitova
Curation notes
-

Experimental Process

Site-directed mutagenesis with lacZ reporter assays confirmed AtzR-dependent activation of atzD. In vitro transcription assays showed cyanuric acid is sufficient to induce AtzR-dependent activation of atzD. EMSAs confirmed specific binding of AtzR to the atzD promoter.

Transcription Factor Binding Sites


GGTGCCGGATCGGCACCAGTTAGGTCGGAAAAAGGCGGCAGTCAAGTGCG
GGTGCCGGATCGGCACCAGTTAGGTCGGAAAAAGGCGGCAGTCAAGTGCG

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
GGTGCCGGATCGGCACCAGTTAGGTCGGAAAAAGGCGGCAGTCAAGTGCG atzD,
... ... atzD orf99 orf98 orf97 orf96 orf95 orf94
Experimental technique details Beta-gal reporter assay - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Site directed mutagenesis (ECO:0005667) - activator tetramer