Curation Information

Publication: Control of Pseudomonas aeruginosa algZ expression by the alternative sigma factor AlgT.;Wozniak DJ, Sprinkle AB, Baynham PJ;Journal of bacteriology 2003 Dec; 185(24):7297-300 [14645293]
TF: AlgU [Q06198, view regulon]
Reported TF sp.: Pseudomonas aeruginosa FRD1
Reported site sp.: Pseudomonas aeruginosa FRD1
Created by: Dinara Sagitova
Curation notes: -

Experimental Process

Primer extension analysis using RNA from the wild type P. aeruginosa FRD1 and algT mutant strains determined that algZ was not expressed in algT mutant. Visual inspection of the algZ promoter identified a putative AlgT binding site with a partial match to AlgT consensus sequence. Site-directed mutagenesis of the putative binding site showed that compared to the wild type expression level, mutations in the AlgT binding site resulted in significant reduction in algZ transcription.

Transcription Factor Binding Sites

Sites reported in the paper
Sites matched in the genome

GAACGGCTAGCGGAAATCGTGGTCATA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence	Regulated genes	Gene diagram	Experimental techniques	TF function	TF type
GAACGGCTAGCGGAAATCGTGGTCATA	amrZ,		Experimental technique details Beta-gal reporter assay Beta-gal reporter assay Reporter assay using the beta-galactosidase (lacZ) gene. The lacZ gene is typically fused to the promoter of interest. Differential regulation of the promoter mediated by the TF is assessed by induction of the system and evaluation of lacZ expression. Bacteria expressing lacZ appear blue when grown on a X-gal medium. The assay is often performed using a plasmid borne construction on a lacZ(def) strain. - Experimental technique details Primer Extension assay (ECO:0005657) Primer Extension assay - ECO:0005657 Primer Extension Assay is a simple method of assessing expression levels. The total RNA produced by the culture is isolated. A short synthetic oligonucleotide primer (complementary to a short sequence on the target RNA) is radiolabelled (usually with 32P) and the primer anneals to the RNA. Reverse transcriptase then extends the RNA producing cDNA. The cDNA is analyzed on a polyacrylamide gel. The amount of cDNA in a band on the gel is proportional to the amount of initial RNA, thus providing expression levels of RNA from the culture. - Experimental technique details Site directed mutagenesis (ECO:0005667) Site directed mutagenesis - ECO:0005667 Target-specific mutation, as opposed to non-specific mutation. In the context of TF-binding sites, site-directed mutagenesis is typically used to establish/confirm the specific sequence and location of a site, often in tandem with EMSA. Different positions of a putative binding site are mutated to non-consensus (or random) bases and binding to the mutated site is evaluated through EMSA or other means. Often implemented only in conserved motif positions or serially through all positions of a site. - Experimental technique details Visual sequence inspection (nan) Visual sequence inspection - nan Visual inspection of promoter region to identify putative binding sites based on previous knowledge -	activator	not specified