Curation Information

Publication: Activation of the catBCA promoter: probing the interaction of CatR and RNA polymerase through in vitro transcription.;Chugani SA, Parsek MR, Hershberger CD, Murakami K, Ishihama A, Chakrabarty AM;Journal of bacteriology 1997 Apr; 179(7):2221-7 [9079907]
TF: CatR [Q88GK5, view regulon]
Reported TF sp.: Pseudomonas putida PRS2000
Reported site sp.: Pseudomonas putida PRS2000
Created by: Matthew Coveyou
Curation notes: -

Experimental Process

In vitro transcription assay of the Pseudomonas putida catBCA promoter demonstrated dependence on both catR and the inducer molecule. DNase I protection in inducer-variable solution identified two catR binding sites, the recognition binding site (RBS) and activation binding site (ABS). The latter was confirmed by methylation interference assay. ABS was only bound in the presence of the inducer, while RBS was found to be inducer-independent.

Transcription Factor Binding Sites

Sites reported in the paper
Sites matched in the genome

TCCATCAGACCTCCAGGGTATGGTGGGAGATTCATTCGATATTGG

TCCATCAGACCTCCAGGGTATGGTGGGAGATTCATTTGATATTGG

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence	Regulated genes	Gene diagram	Experimental techniques	TF function	TF type
TCCATCAGACCTCCAGGGTATGGTGGGAGATTCATTTGATATTGG	catB, catC, catA,		Experimental technique details DNAse footprinting (ECO:0005631) DNAse footprinting - ECO:0005631 The DNAse foot-printing method starts by focusing on a given region of interest (e.g. a promoter region) and amplifying it by PCR to obtain lots of sample. It then throws in the TF and then the DNAse. The mix is left to stir for a short time and then gel electrophoresis is run to compare the pattern of fragments in a control (no TF) and in the sample. If the TF has bound the sample, it will have protected a stretch of DNA (encompassing some fragments of the control) and thus those fragments will not appear in the sample gel. The fragments can then be cut-out from the gel, purified and sequenced to obtain the sequence of the protected region. This is often used to identify the binding motif of a TF for the first time. The foot-printing will typically resolve the protected region down to 50-100 bp, and the sequence can be then examined for possible TF-binding sites either by eye of using a computer search. - Experimental technique details In-vitro transcription (ECO:0001204) In-vitro transcription - ECO:0001204 In-vitro transcription is often used to validate that a particular TF can or cannot activate/repress a gene in the absence of other proteins that are present in in vivo conditions. - Experimental technique details Premethylation interference footprinting (ECO:0005656) Premethylation interference footprinting - ECO:0005656 A variation of DNAse footprinting in which certain residues are methylated to evidence their role in binding. Similar to site-directed mutagenesis in its ability to designate specific residues as being essential for binding. -	activator	tetramer